ID: 933425301

View in Genome Browser
Species Human (GRCh38)
Location 2:82103686-82103708
Sequence TATATGACATCCTACTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933425300_933425301 11 Left 933425300 2:82103652-82103674 CCAATAGAAAACTGGAGAATTAC No data
Right 933425301 2:82103686-82103708 TATATGACATCCTACTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933425301 Original CRISPR TATATGACATCCTACTTTTC AGG Intergenic
No off target data available for this crispr