ID: 933426850

View in Genome Browser
Species Human (GRCh38)
Location 2:82124822-82124844
Sequence GTCAGCACTGCTGCCAGACG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933426844_933426850 4 Left 933426844 2:82124795-82124817 CCAAGCACCGTGACTCATCCCTG No data
Right 933426850 2:82124822-82124844 GTCAGCACTGCTGCCAGACGGGG No data
933426845_933426850 -3 Left 933426845 2:82124802-82124824 CCGTGACTCATCCCTGTAATGTC No data
Right 933426850 2:82124822-82124844 GTCAGCACTGCTGCCAGACGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933426850 Original CRISPR GTCAGCACTGCTGCCAGACG GGG Intergenic
No off target data available for this crispr