ID: 933433247

View in Genome Browser
Species Human (GRCh38)
Location 2:82212340-82212362
Sequence ATGGATTTACATGGTTTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933433240_933433247 13 Left 933433240 2:82212304-82212326 CCCAATGATCATTCAGGAGCAGG 0: 125
1: 380
2: 705
3: 8195
4: 4820
Right 933433247 2:82212340-82212362 ATGGATTTACATGGTTTTGAGGG No data
933433242_933433247 12 Left 933433242 2:82212305-82212327 CCAATGATCATTCAGGAGCAGGT 0: 124
1: 410
2: 742
3: 8596
4: 4939
Right 933433247 2:82212340-82212362 ATGGATTTACATGGTTTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933433247 Original CRISPR ATGGATTTACATGGTTTTGA GGG Intergenic
No off target data available for this crispr