ID: 933436397

View in Genome Browser
Species Human (GRCh38)
Location 2:82255884-82255906
Sequence CAGGGAGAATGGAATAAAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933436397_933436402 7 Left 933436397 2:82255884-82255906 CCAACTTTATTCCATTCTCCCTG No data
Right 933436402 2:82255914-82255936 CAGGTACCTCAGTCAATCATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933436397 Original CRISPR CAGGGAGAATGGAATAAAGT TGG (reversed) Intergenic
No off target data available for this crispr