ID: 933436633

View in Genome Browser
Species Human (GRCh38)
Location 2:82257647-82257669
Sequence GAGAATAAGGAAAAGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933436633_933436641 14 Left 933436633 2:82257647-82257669 CCACCCTGCTTTTCCTTATTCTC No data
Right 933436641 2:82257684-82257706 TCCACCTAGTCAGTCCCAGTGGG No data
933436633_933436640 13 Left 933436633 2:82257647-82257669 CCACCCTGCTTTTCCTTATTCTC No data
Right 933436640 2:82257683-82257705 GTCCACCTAGTCAGTCCCAGTGG No data
933436633_933436644 23 Left 933436633 2:82257647-82257669 CCACCCTGCTTTTCCTTATTCTC No data
Right 933436644 2:82257693-82257715 TCAGTCCCAGTGGGAGAACCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933436633 Original CRISPR GAGAATAAGGAAAAGCAGGG TGG (reversed) Intergenic
No off target data available for this crispr