ID: 933443754

View in Genome Browser
Species Human (GRCh38)
Location 2:82350174-82350196
Sequence TCCCAAAGCCGAAGTGGGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933443754_933443765 16 Left 933443754 2:82350174-82350196 CCATGCCCACTTCGGCTTTGGGA No data
Right 933443765 2:82350213-82350235 CCTAGACGCTACTGTGGGGCTGG No data
933443754_933443759 10 Left 933443754 2:82350174-82350196 CCATGCCCACTTCGGCTTTGGGA No data
Right 933443759 2:82350207-82350229 CCCATCCCTAGACGCTACTGTGG No data
933443754_933443761 11 Left 933443754 2:82350174-82350196 CCATGCCCACTTCGGCTTTGGGA No data
Right 933443761 2:82350208-82350230 CCATCCCTAGACGCTACTGTGGG No data
933443754_933443762 12 Left 933443754 2:82350174-82350196 CCATGCCCACTTCGGCTTTGGGA No data
Right 933443762 2:82350209-82350231 CATCCCTAGACGCTACTGTGGGG No data
933443754_933443766 26 Left 933443754 2:82350174-82350196 CCATGCCCACTTCGGCTTTGGGA No data
Right 933443766 2:82350223-82350245 ACTGTGGGGCTGGAGCCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933443754 Original CRISPR TCCCAAAGCCGAAGTGGGCA TGG (reversed) Intergenic
No off target data available for this crispr