ID: 933444378

View in Genome Browser
Species Human (GRCh38)
Location 2:82359862-82359884
Sequence TGCAGGATCTCACTTATATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933444378_933444380 29 Left 933444378 2:82359862-82359884 CCACATATAAGTGAGATCCTGCA No data
Right 933444380 2:82359914-82359936 CACATAGCATAATGTCCTCAAGG 0: 12
1: 278
2: 1240
3: 2941
4: 4309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933444378 Original CRISPR TGCAGGATCTCACTTATATG TGG (reversed) Intergenic
No off target data available for this crispr