ID: 933444379

View in Genome Browser
Species Human (GRCh38)
Location 2:82359879-82359901
Sequence CACAGAAAGACAAATACTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933444379_933444380 12 Left 933444379 2:82359879-82359901 CCTGCAGTATTTGTCTTTCTGTG No data
Right 933444380 2:82359914-82359936 CACATAGCATAATGTCCTCAAGG 0: 12
1: 278
2: 1240
3: 2941
4: 4309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933444379 Original CRISPR CACAGAAAGACAAATACTGC AGG (reversed) Intergenic
No off target data available for this crispr