ID: 933444380

View in Genome Browser
Species Human (GRCh38)
Location 2:82359914-82359936
Sequence CACATAGCATAATGTCCTCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8780
Summary {0: 12, 1: 278, 2: 1240, 3: 2941, 4: 4309}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933444378_933444380 29 Left 933444378 2:82359862-82359884 CCACATATAAGTGAGATCCTGCA No data
Right 933444380 2:82359914-82359936 CACATAGCATAATGTCCTCAAGG 0: 12
1: 278
2: 1240
3: 2941
4: 4309
933444379_933444380 12 Left 933444379 2:82359879-82359901 CCTGCAGTATTTGTCTTTCTGTG No data
Right 933444380 2:82359914-82359936 CACATAGCATAATGTCCTCAAGG 0: 12
1: 278
2: 1240
3: 2941
4: 4309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933444380 Original CRISPR CACATAGCATAATGTCCTCA AGG Intergenic
Too many off-targets to display for this crispr