ID: 933445249

View in Genome Browser
Species Human (GRCh38)
Location 2:82371569-82371591
Sequence GTTCCATAGAATTGCACCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933445249_933445251 30 Left 933445249 2:82371569-82371591 CCAGAGGTGCAATTCTATGGAAC No data
Right 933445251 2:82371622-82371644 ATAAATCTACCTCTTAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933445249 Original CRISPR GTTCCATAGAATTGCACCTC TGG (reversed) Intergenic
No off target data available for this crispr