ID: 933445250

View in Genome Browser
Species Human (GRCh38)
Location 2:82371597-82371619
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933445250_933445251 2 Left 933445250 2:82371597-82371619 CCTGCAACGTGTGAGAGTTTGAA No data
Right 933445251 2:82371622-82371644 ATAAATCTACCTCTTAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933445250 Original CRISPR TTCAAACTCTCACACGTTGC AGG (reversed) Intergenic
No off target data available for this crispr