ID: 933449934

View in Genome Browser
Species Human (GRCh38)
Location 2:82435780-82435802
Sequence CTTACAATGGAGAAACCGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933449934_933449940 5 Left 933449934 2:82435780-82435802 CCTCCCGGTTTCTCCATTGTAAG No data
Right 933449940 2:82435808-82435830 CTTTGCCCCCTGTTAATAAATGG No data
933449934_933449944 11 Left 933449934 2:82435780-82435802 CCTCCCGGTTTCTCCATTGTAAG No data
Right 933449944 2:82435814-82435836 CCCCTGTTAATAAATGGTTTGGG No data
933449934_933449942 10 Left 933449934 2:82435780-82435802 CCTCCCGGTTTCTCCATTGTAAG No data
Right 933449942 2:82435813-82435835 CCCCCTGTTAATAAATGGTTTGG No data
933449934_933449947 14 Left 933449934 2:82435780-82435802 CCTCCCGGTTTCTCCATTGTAAG No data
Right 933449947 2:82435817-82435839 CTGTTAATAAATGGTTTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933449934 Original CRISPR CTTACAATGGAGAAACCGGG AGG (reversed) Intergenic
No off target data available for this crispr