ID: 933455050

View in Genome Browser
Species Human (GRCh38)
Location 2:82508972-82508994
Sequence TCATTCTGCCCACTTTGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933455050_933455058 18 Left 933455050 2:82508972-82508994 CCTGGCCAAAGTGGGCAGAATGA No data
Right 933455058 2:82509013-82509035 AACTTGTGCAAAAGTGCCACTGG No data
933455050_933455059 27 Left 933455050 2:82508972-82508994 CCTGGCCAAAGTGGGCAGAATGA No data
Right 933455059 2:82509022-82509044 AAAAGTGCCACTGGCCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933455050 Original CRISPR TCATTCTGCCCACTTTGGCC AGG (reversed) Intergenic