ID: 933455051

View in Genome Browser
Species Human (GRCh38)
Location 2:82508977-82508999
Sequence TGGGCTCATTCTGCCCACTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933455051_933455059 22 Left 933455051 2:82508977-82508999 CCAAAGTGGGCAGAATGAGCCCA No data
Right 933455059 2:82509022-82509044 AAAAGTGCCACTGGCCACAGAGG No data
933455051_933455058 13 Left 933455051 2:82508977-82508999 CCAAAGTGGGCAGAATGAGCCCA No data
Right 933455058 2:82509013-82509035 AACTTGTGCAAAAGTGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933455051 Original CRISPR TGGGCTCATTCTGCCCACTT TGG (reversed) Intergenic