ID: 933455054

View in Genome Browser
Species Human (GRCh38)
Location 2:82508996-82509018
Sequence CAAGTTTGCTTGGGCCCACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933455054_933455061 14 Left 933455054 2:82508996-82509018 CCCAGTGGGCCCAAGCAAACTTG No data
Right 933455061 2:82509033-82509055 TGGCCACAGAGGTTTCCAGCTGG No data
933455054_933455059 3 Left 933455054 2:82508996-82509018 CCCAGTGGGCCCAAGCAAACTTG No data
Right 933455059 2:82509022-82509044 AAAAGTGCCACTGGCCACAGAGG No data
933455054_933455058 -6 Left 933455054 2:82508996-82509018 CCCAGTGGGCCCAAGCAAACTTG No data
Right 933455058 2:82509013-82509035 AACTTGTGCAAAAGTGCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933455054 Original CRISPR CAAGTTTGCTTGGGCCCACT GGG (reversed) Intergenic