ID: 933455056

View in Genome Browser
Species Human (GRCh38)
Location 2:82509005-82509027
Sequence ACTTTTGCACAAGTTTGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933455056_933455059 -6 Left 933455056 2:82509005-82509027 CCCAAGCAAACTTGTGCAAAAGT No data
Right 933455059 2:82509022-82509044 AAAAGTGCCACTGGCCACAGAGG No data
933455056_933455061 5 Left 933455056 2:82509005-82509027 CCCAAGCAAACTTGTGCAAAAGT No data
Right 933455061 2:82509033-82509055 TGGCCACAGAGGTTTCCAGCTGG 0: 52
1: 87
2: 160
3: 214
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933455056 Original CRISPR ACTTTTGCACAAGTTTGCTT GGG (reversed) Intergenic
No off target data available for this crispr