ID: 933455057

View in Genome Browser
Species Human (GRCh38)
Location 2:82509006-82509028
Sequence CACTTTTGCACAAGTTTGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933455057_933455061 4 Left 933455057 2:82509006-82509028 CCAAGCAAACTTGTGCAAAAGTG No data
Right 933455061 2:82509033-82509055 TGGCCACAGAGGTTTCCAGCTGG No data
933455057_933455059 -7 Left 933455057 2:82509006-82509028 CCAAGCAAACTTGTGCAAAAGTG No data
Right 933455059 2:82509022-82509044 AAAAGTGCCACTGGCCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933455057 Original CRISPR CACTTTTGCACAAGTTTGCT TGG (reversed) Intergenic