ID: 933455059

View in Genome Browser
Species Human (GRCh38)
Location 2:82509022-82509044
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933455057_933455059 -7 Left 933455057 2:82509006-82509028 CCAAGCAAACTTGTGCAAAAGTG No data
Right 933455059 2:82509022-82509044 AAAAGTGCCACTGGCCACAGAGG No data
933455051_933455059 22 Left 933455051 2:82508977-82508999 CCAAAGTGGGCAGAATGAGCCCA No data
Right 933455059 2:82509022-82509044 AAAAGTGCCACTGGCCACAGAGG No data
933455050_933455059 27 Left 933455050 2:82508972-82508994 CCTGGCCAAAGTGGGCAGAATGA No data
Right 933455059 2:82509022-82509044 AAAAGTGCCACTGGCCACAGAGG No data
933455054_933455059 3 Left 933455054 2:82508996-82509018 CCCAGTGGGCCCAAGCAAACTTG No data
Right 933455059 2:82509022-82509044 AAAAGTGCCACTGGCCACAGAGG No data
933455055_933455059 2 Left 933455055 2:82508997-82509019 CCAGTGGGCCCAAGCAAACTTGT No data
Right 933455059 2:82509022-82509044 AAAAGTGCCACTGGCCACAGAGG No data
933455056_933455059 -6 Left 933455056 2:82509005-82509027 CCCAAGCAAACTTGTGCAAAAGT No data
Right 933455059 2:82509022-82509044 AAAAGTGCCACTGGCCACAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type