ID: 933455061

View in Genome Browser
Species Human (GRCh38)
Location 2:82509033-82509055
Sequence TGGCCACAGAGGTTTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933455056_933455061 5 Left 933455056 2:82509005-82509027 CCCAAGCAAACTTGTGCAAAAGT No data
Right 933455061 2:82509033-82509055 TGGCCACAGAGGTTTCCAGCTGG No data
933455057_933455061 4 Left 933455057 2:82509006-82509028 CCAAGCAAACTTGTGCAAAAGTG No data
Right 933455061 2:82509033-82509055 TGGCCACAGAGGTTTCCAGCTGG No data
933455054_933455061 14 Left 933455054 2:82508996-82509018 CCCAGTGGGCCCAAGCAAACTTG No data
Right 933455061 2:82509033-82509055 TGGCCACAGAGGTTTCCAGCTGG No data
933455055_933455061 13 Left 933455055 2:82508997-82509019 CCAGTGGGCCCAAGCAAACTTGT No data
Right 933455061 2:82509033-82509055 TGGCCACAGAGGTTTCCAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933455061 Original CRISPR TGGCCACAGAGGTTTCCAGC TGG Intergenic