ID: 933455061

View in Genome Browser
Species Human (GRCh38)
Location 2:82509033-82509055
Sequence TGGCCACAGAGGTTTCCAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 892
Summary {0: 52, 1: 87, 2: 160, 3: 214, 4: 379}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933455054_933455061 14 Left 933455054 2:82508996-82509018 CCCAGTGGGCCCAAGCAAACTTG No data
Right 933455061 2:82509033-82509055 TGGCCACAGAGGTTTCCAGCTGG 0: 52
1: 87
2: 160
3: 214
4: 379
933455056_933455061 5 Left 933455056 2:82509005-82509027 CCCAAGCAAACTTGTGCAAAAGT No data
Right 933455061 2:82509033-82509055 TGGCCACAGAGGTTTCCAGCTGG 0: 52
1: 87
2: 160
3: 214
4: 379
933455055_933455061 13 Left 933455055 2:82508997-82509019 CCAGTGGGCCCAAGCAAACTTGT No data
Right 933455061 2:82509033-82509055 TGGCCACAGAGGTTTCCAGCTGG 0: 52
1: 87
2: 160
3: 214
4: 379
933455057_933455061 4 Left 933455057 2:82509006-82509028 CCAAGCAAACTTGTGCAAAAGTG No data
Right 933455061 2:82509033-82509055 TGGCCACAGAGGTTTCCAGCTGG 0: 52
1: 87
2: 160
3: 214
4: 379

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933455061 Original CRISPR TGGCCACAGAGGTTTCCAGC TGG Intergenic
900234203 1:1578921-1578943 CAGACACAGAGGTTTCCGGCTGG + Intergenic
900627231 1:3614005-3614027 TGACCGCAGGGATTTCCAGCAGG - Intergenic
900986570 1:6076634-6076656 TGGCCACAGGGGGTTCCACCTGG + Intronic
901965849 1:12864979-12865001 CAGCCACAGAGGTTTCTGGCCGG + Intronic
902388299 1:16088520-16088542 TGAGCACAGCGGTTTCCTGCTGG - Intergenic
902768939 1:18634549-18634571 TTGCCACAGAGGCTGGCAGCTGG + Intronic
904015450 1:27416525-27416547 TGTGCACACAGGTTTCCAGTGGG - Intronic
904365678 1:30009680-30009702 CGGCCACAGAGGTTTCTGGCTGG - Intergenic
904443935 1:30552091-30552113 TGACCACAGAGGCTTCTGGCTGG + Intergenic
905214977 1:36400580-36400602 TAGCCACAGAGGTTTCCAGATGG - Intergenic
905887373 1:41498651-41498673 TGACCACAGAGATTTACAGGAGG - Intergenic
906051661 1:42879841-42879863 TGGCCACAGAGGCTTCCAGCTGG - Intergenic
906913671 1:49983601-49983623 TGGCTACAGAGGTTTCCAGCTGG + Intronic
907020412 1:51060965-51060987 TGGCCACAGAGGTTTCCAACTGG + Intergenic
907289488 1:53403571-53403593 TGACCACAGAGGTTTCCAGCTGG + Intergenic
907370860 1:54002570-54002592 TGCCAGCAGAGGTTTTCAGCAGG - Intergenic
907614959 1:55913847-55913869 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
907985495 1:59525384-59525406 CAGCCACAGAGGTTTCCGGCTGG + Intronic
909054430 1:70805662-70805684 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
909197942 1:72649817-72649839 TCGCCACAGAGGTTTCTGGCTGG + Intergenic
910028599 1:82688804-82688826 CAGCCACAGAGGTTTCTGGCTGG - Intergenic
910101306 1:83581845-83581867 GGGCCACAGAGGTTTCTGGTTGG - Intergenic
910173632 1:84404377-84404399 TGAACACAGATTTTTCCAGCAGG + Intronic
910242520 1:85103026-85103048 AGGCCACAGAGATGTCCATCAGG + Intronic
910260033 1:85285291-85285313 TGGCCACACAGGTTTCCGGCTGG + Intergenic
910360869 1:86412708-86412730 TGACCACAGATGGTTTCAGCTGG - Intergenic
910380419 1:86621294-86621316 TGGCCACAGATGTTACTGGCTGG + Intergenic
910601972 1:89042506-89042528 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
910690640 1:89962127-89962149 TGGCCACAGGGAGTTCCAGCAGG + Intergenic
911025611 1:93433574-93433596 TGGCCACAGAGGTTTCCAGCAGG - Intergenic
911267097 1:95754709-95754731 TAGCTACAGAGGTTTCCAGCTGG + Intergenic
911435141 1:97846153-97846175 TGAACACAGAGGTTTCCGGCTGG + Intronic
911475283 1:98366342-98366364 CAGCCACAGAGGTTTCCTCCTGG - Intergenic
911497516 1:98649938-98649960 TAGCCACCAAGGTTTCCAGCTGG - Intergenic
912008801 1:104934153-104934175 GGACCTAAGAGGTTTCCAGCTGG + Intergenic
912044629 1:105438176-105438198 GTGCCACAGAGGTTTCTGGCTGG + Intergenic
912716401 1:111987071-111987093 TGGCCACACAGGGTTCCACAGGG - Intronic
913119963 1:115730938-115730960 GAGCCTCAGTGGTTTCCAGCAGG - Intronic
914757917 1:150575722-150575744 GGGTCACTCAGGTTTCCAGCAGG + Exonic
915359473 1:155277542-155277564 TGGCCACAGAGGGCTCTAGGAGG + Intronic
915828634 1:159104960-159104982 TGGACACAGGGGTTTCCGGCTGG - Intronic
917020427 1:170580741-170580763 TGCCCACAGAGGTTTTCTTCTGG - Intergenic
917848673 1:179042084-179042106 CGGCCACAGAGGTTTCTCACTGG - Intronic
918820763 1:189250914-189250936 CTGCCACAGAGGTTTCCAGCTGG + Intergenic
919168611 1:193926975-193926997 CAGCCACAGAGGTTTCTGGCTGG - Intergenic
919188239 1:194182109-194182131 CAGCCACAGAGATTTCCGGCTGG + Intergenic
919262821 1:195219104-195219126 GGGCCACAGAGGTTTCCGGCTGG + Intergenic
919343559 1:196345470-196345492 GGGCCACAGAGGTAACTAGCTGG + Intronic
919454087 1:197802037-197802059 TGCCCACAGAGGTTTCTGGCTGG + Intergenic
920418109 1:205812400-205812422 TGGACTCAGAGGTTTCCTCCTGG - Intronic
920722433 1:208400150-208400172 TGGCCACAGACTTTGCCAGGGGG - Intergenic
921625531 1:217374094-217374116 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
921675392 1:217969758-217969780 CAGCCACAGAGGTTTCCGGCTGG + Intergenic
921705841 1:218322756-218322778 TGGTCACAGAGGTTTCCAGCTGG - Intronic
921766791 1:218982554-218982576 CAGCCACAGAGGTTTCCAGTTGG - Intergenic
922141528 1:222893331-222893353 CAGCTACAGAGGTTTCCAGTTGG - Intronic
922467801 1:225856305-225856327 TGGCCACAAAATTTTCAAGCTGG + Intronic
922572874 1:226644212-226644234 TGTCCACAGGGGGTGCCAGCTGG + Intronic
923917810 1:238529295-238529317 TGGCCACAGAGTTTTCTGGCTGG - Intergenic
1062830179 10:600221-600243 TGGTCACTGAGGGTTCCAGTAGG - Intronic
1064010474 10:11731144-11731166 TGGCCACAGAGGTTTCTGGGTGG + Intergenic
1065201309 10:23316007-23316029 TGACCACAGAGGTTTCTGGCTGG - Intronic
1065408353 10:25392462-25392484 TGGCCACAGAGGTTTCTGGCTGG + Intronic
1065806259 10:29395819-29395841 TACTCACAGAGGTTTCCAGCTGG + Intergenic
1065830505 10:29609954-29609976 CAGCAACAGAGGTTTCCAGCTGG + Intronic
1065976691 10:30847998-30848020 TGGCCACAGAGGTTTCCGGCTGG + Intronic
1066586705 10:36944001-36944023 TAGCCACACAGGTTTCCAGGGGG + Intergenic
1067258491 10:44666067-44666089 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
1067523470 10:47025086-47025108 TGATGGCAGAGGTTTCCAGCTGG - Intergenic
1068157531 10:53221804-53221826 CAGCCACAGAGGTTTCTGGCTGG - Intergenic
1068226806 10:54117021-54117043 TGGCCGCAGAAGTTTCCAGCTGG - Intronic
1068283514 10:54908063-54908085 TGGCCACAGAGGTTTCCAGCTGG - Intronic
1068291084 10:55001803-55001825 CAGCCACAGAGGTTTCTGGCTGG + Intronic
1068444021 10:57096448-57096470 TGGCCATTGAAGTTTACAGCTGG + Intergenic
1068528083 10:58153873-58153895 TGGCCACAGAGGGAACTAGCAGG + Intergenic
1068919439 10:62466562-62466584 TGGCCATAGAGGTTTCTGGCTGG + Intronic
1068938588 10:62658839-62658861 TGGCCACAGAGGTTTCCAGCTGG + Intronic
1069156406 10:65035582-65035604 TGGCCACAGAGGTTTATAGCTGG + Intergenic
1069160125 10:65083307-65083329 TGGCCACAGAATTTTCTGGCTGG - Intergenic
1069212652 10:65780346-65780368 CAGCCACAGAGGTTTCTGGCTGG + Intergenic
1069561610 10:69434972-69434994 CGGCCACAGAGGTTTCTGGTTGG - Intergenic
1069643414 10:69971938-69971960 TGGCCCCTGTGGTTCCCAGCGGG - Intergenic
1069904318 10:71723588-71723610 TGGCCACACTGGGTCCCAGCCGG - Intronic
1070096050 10:73339446-73339468 CAGCCACAGAGGTTTTCTGCTGG - Intronic
1071167327 10:82822181-82822203 TGCCCAGAGAAGTTTCCAGCAGG + Intronic
1073733712 10:106321188-106321210 TGGCCACAGAGGTTTCCATCTGG + Intergenic
1073816179 10:107209950-107209972 TGGCCACAGATTTTTAGAGCGGG + Intergenic
1073845233 10:107546095-107546117 CAGCCACAGAGGTTTCCGGCTGG + Intergenic
1074323932 10:112429787-112429809 CAGCCACAGAGGATTCCAGCTGG - Intergenic
1074517550 10:114184561-114184583 TGGCCACAGAGTTCTCCTGAGGG - Intronic
1074529255 10:114285979-114286001 TGCCCGCAGAGCTGTCCAGCAGG - Exonic
1075131932 10:119747954-119747976 TGGCCACAGAAGTGTCCAGGTGG - Intronic
1077359127 11:2132912-2132934 TGACCACGGACGTTTCCATCAGG - Exonic
1077414094 11:2416475-2416497 TGAGGACAGCGGTTTCCAGCAGG - Intronic
1078086288 11:8234644-8234666 TGGCCACAGTGGCTTCCAGCAGG - Intronic
1078145167 11:8717509-8717531 TGTCCACAGAGGTTTCAACATGG + Intronic
1078345386 11:10543824-10543846 CGGCCACAGAGGTTTCTGGCTGG - Intergenic
1078836347 11:15034520-15034542 CAGCCACAGAGGTTTCTAGCCGG - Intronic
1078874466 11:15379264-15379286 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
1079183965 11:18220302-18220324 TGGCCACAGAGGTTTCCAGCAGG - Intronic
1079503800 11:21132305-21132327 CAGCCACAGAGGTTTCCAGCTGG - Intronic
1079997139 11:27306043-27306065 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
1080208176 11:29755515-29755537 TGACCACAGAGGTTTCCAGCCGG - Intergenic
1080706838 11:34702655-34702677 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1080851846 11:36077362-36077384 TGGCCACAGAAATTTCCAGTTGG - Intronic
1081043979 11:38249718-38249740 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1081163782 11:39784873-39784895 TGGTCACAGAGGTTTCCAGCTGG - Intergenic
1081237311 11:40660398-40660420 TGGCCACAGAAGTTTCTGGCTGG + Intronic
1081388748 11:42503825-42503847 TGTCCAGAGAGGTTTGCTGCAGG - Intergenic
1082687549 11:56259488-56259510 AGGCCACAGAGGTTTCAAGCTGG - Intergenic
1083916262 11:65745423-65745445 GGGCCATGGAGGTTTCCAGCTGG + Intergenic
1084563819 11:69918627-69918649 GGGCGACAGAGGCTTCCAGGGGG - Intergenic
1085042816 11:73336580-73336602 TTGCCCCAGAGGGGTCCAGCTGG - Intronic
1085212039 11:74790482-74790504 CAGCCACAGAGGTTTCCAGCTGG - Intronic
1085334071 11:75678036-75678058 CGGCCGCAGAGGTTTCCAGCTGG - Intergenic
1085404090 11:76251464-76251486 CAACCACAGAGGTTTCCAGCTGG + Intergenic
1085435319 11:76494275-76494297 CGGCCACAGACGTTTCTGGCTGG + Intronic
1085610707 11:77945984-77946006 TAGCCACAGAGCTGCCCAGCAGG + Intronic
1085751014 11:79161230-79161252 TGGGCAAAGAGGTTTCCTCCTGG - Intronic
1086084612 11:82942383-82942405 TGGCCACAGAGGTTTCTGGTTGG - Intronic
1086249486 11:84796092-84796114 TAGTCAAAGAGGTTTCCAGCTGG + Intronic
1086268095 11:85027408-85027430 CTGCCACAGAGGTTTCTGGCTGG - Intronic
1086508149 11:87527730-87527752 TGTACACAGAGGTTTTCAGCTGG - Intergenic
1086818596 11:91406093-91406115 TGGCCACCTAGGTCTCCAGCTGG - Intergenic
1086850389 11:91800540-91800562 CAGCCACAGAGGTTTCTGGCTGG + Intergenic
1086946917 11:92852977-92852999 CAGCCATAGAGGTTTTCAGCTGG - Intronic
1087131525 11:94672949-94672971 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1087407735 11:97751457-97751479 CAGCCACAGAGGTTTCTGGCTGG - Intergenic
1087453281 11:98352479-98352501 TGGCCACTAAGGTTTCTGGCTGG - Intergenic
1087534268 11:99424355-99424377 CAGCCACAGAGGTTTCCAGCTGG - Intronic
1087891822 11:103544525-103544547 TGACCACAGATGGTTTCAGCTGG - Intergenic
1088186424 11:107176546-107176568 TGGCGAGAGAGGTTCCCAGGAGG - Intergenic
1088287815 11:108206243-108206265 CAGCCACAGAGGTTTCGAACTGG - Intronic
1088684491 11:112273638-112273660 TGACCACAGATGTTTCTAGTTGG - Intergenic
1090042076 11:123300056-123300078 CGGCCACAGAGGTTTCCGGTTGG + Intergenic
1090514475 11:127411232-127411254 CAGCCACAGAGGTTTCTGGCCGG - Intergenic
1091484685 12:873983-874005 TGGTCACAAAGCTTTTCAGCAGG - Intronic
1091818682 12:3458361-3458383 TGGGCACAGAGCTGTGCAGCAGG + Intronic
1092271878 12:7030271-7030293 CAGCCACAGAGGTTTCCAGTGGG - Intronic
1093298185 12:17417118-17417140 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1093502302 12:19827183-19827205 CAGCCACAGAGGTTTCTGGCTGG - Intergenic
1093525546 12:20101172-20101194 CAGCTACAGAGGTTTCCAGCTGG - Intergenic
1093535329 12:20216652-20216674 ATGACACAGAGGTTTTCAGCTGG + Intergenic
1094382351 12:29856366-29856388 TGGACACAGAGGTTTCAACTGGG + Intergenic
1094382984 12:29863853-29863875 TGGAAACAGTGGCTTCCAGCTGG - Intergenic
1095443926 12:42266714-42266736 CCGCCACAGAGGCTTCCTGCCGG - Intronic
1095603362 12:44038648-44038670 TGGCCACAGAGGTTTCCAGCTGG + Intronic
1095829505 12:46569467-46569489 GGGCCACAGAGATGTTCAGCTGG + Intergenic
1096294900 12:50375798-50375820 TGGCCACAGAGGTTTCTGGCTGG - Intronic
1096953276 12:55498713-55498735 AGGCCACACATATTTCCAGCAGG - Intergenic
1097078434 12:56412220-56412242 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1097360644 12:58655343-58655365 TAGCCACAGAGGTTTCTGGCTGG - Intronic
1097450549 12:59733154-59733176 TGGTCACAGAGGTTTTGGGCTGG - Intronic
1097491840 12:60281524-60281546 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
1097500392 12:60393429-60393451 TGGCCAGAAACATTTCCAGCTGG + Intergenic
1097508675 12:60507933-60507955 TGCCCACAGAGGTTTCTGCCAGG - Intergenic
1097684382 12:62677762-62677784 CAGCCACAGTGGTTTCCGGCTGG + Intronic
1098290745 12:68955190-68955212 CAGCCACAGAGGCTTCCAGCTGG + Intronic
1098465567 12:70783076-70783098 CAGCCACAGAGGTTTCTGGCCGG - Intronic
1098663134 12:73124770-73124792 TAGCCACAGAGGATCTCAGCGGG - Intergenic
1098767950 12:74514181-74514203 GGGCCACAGAGATTCCCAGCTGG - Intergenic
1098790707 12:74817833-74817855 TGACCACAGAGGTTTTTGGCTGG + Intergenic
1099049608 12:77767340-77767362 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1099554303 12:84091723-84091745 TGTCCACAGGGGTTTCCACTTGG - Intergenic
1099557720 12:84129721-84129743 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
1099683190 12:85855325-85855347 CGGCCACAGAAGTTTCAAGCTGG - Intergenic
1099683347 12:85856355-85856377 TGGCCACAGAGGTTTCTAGCTGG + Intergenic
1099713913 12:86265310-86265332 CAGCCACAGAGGTTCCCAGCTGG + Intronic
1099738726 12:86602281-86602303 TGGCCACAGAGGTTTGTGGCTGG + Intronic
1100292356 12:93229859-93229881 TGGCCACAGAGTGTTGCAGGGGG + Intergenic
1100295433 12:93256685-93256707 AGGTCAAAGAGCTTTCCAGCAGG - Intergenic
1101158584 12:101951345-101951367 TAGCCACAGATGTTTGCAGAAGG - Intronic
1101580743 12:106039265-106039287 TGGCTGCAGAGGTTTCCGGCTGG - Intergenic
1101789101 12:107911884-107911906 TGGCTACAGAGGTTTCCCAGAGG - Intergenic
1103581354 12:121918021-121918043 TGGCCACACGGGTTTCCACTGGG - Exonic
1105042062 12:132968288-132968310 AGGCCACAGAGGTTTCTGGCTGG + Intergenic
1105837681 13:24225056-24225078 AGCCCACAGAGGTTTCCAGCTGG - Intronic
1106253360 13:28001021-28001043 GAGCCACAAAGGTTTCCAGCTGG - Intergenic
1106325596 13:28685479-28685501 CAGCCACAGAGGCTTCCAGCTGG + Intergenic
1106892031 13:34256075-34256097 TTACCACAGAAGTTTCCAACGGG - Intergenic
1106978947 13:35255304-35255326 TAGCCACAGAGGTTTCTGGCTGG - Intronic
1106999433 13:35526586-35526608 AGGCCACAGAGGTTTCCAGCTGG - Intronic
1107542364 13:41403130-41403152 TGGCCACAGAGGTTTCCGGCTGG - Intergenic
1108249751 13:48552113-48552135 CGGCCACAGAGGTTTCTGGCTGG + Intergenic
1108559203 13:51626803-51626825 TGGCCACAGAGGTTCCTGGCTGG - Intronic
1108854278 13:54774559-54774581 TGGTGACAGACATTTCCAGCTGG - Intergenic
1108933305 13:55859226-55859248 TGGCCATGGAGATTTCTAGCTGG - Intergenic
1109158010 13:58935780-58935802 TGGCCGCAGAGATTTCTGGCTGG - Intergenic
1109420639 13:62106554-62106576 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
1109512494 13:63397140-63397162 TGGCCATGGAGGTTTCTGGCTGG + Intergenic
1109562698 13:64074951-64074973 CAGCCACAGAGGTTTCCGGCTGG - Intergenic
1109603732 13:64664094-64664116 TGGTCACAGAGGTTTCCTGCTGG + Intergenic
1109687942 13:65844797-65844819 TGGCCACAGAAGTTGCTGGCTGG + Intergenic
1109762185 13:66844928-66844950 TGGCCATAGAGTTTTCTGGCTGG - Intronic
1109804218 13:67416571-67416593 CGGCCACAGAGATTTCCAGCTGG + Intergenic
1109829530 13:67769474-67769496 CAGCCACAGAGATTTTCAGCTGG - Intergenic
1109837594 13:67878725-67878747 TGGCCACCGAGGTATCTGGCTGG + Intergenic
1109982420 13:69925129-69925151 CGGACACAGAGGTTTTCAGCTGG + Intronic
1110005119 13:70256006-70256028 TGGCCAAAGAGGCTTCCATCTGG + Intergenic
1110343068 13:74414778-74414800 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1110438976 13:75507095-75507117 CAGCCAAAGAAGTTTCCAGCTGG - Intergenic
1110778142 13:79433342-79433364 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1110850625 13:80241085-80241107 TGGCCAAGGAGGTTTCCGGCTGG - Intergenic
1110980512 13:81890634-81890656 CAGCCACAGAGGTTCCTAGCTGG + Intergenic
1111002827 13:82206584-82206606 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
1111034496 13:82655248-82655270 TGGCCACAGAGATTCCCAGCTGG - Intergenic
1111072018 13:83182856-83182878 TGACCCCAGAGGTTTCCAGCTGG - Intergenic
1111091695 13:83454087-83454109 CGGCCGCAGGCGTTTCCAGCGGG + Intergenic
1111243882 13:85509244-85509266 TGGCCACAGAAGTTTCTGGCCGG + Intergenic
1111253528 13:85638275-85638297 TGGCCACAGAAGTTTCTGACTGG - Intergenic
1111354230 13:87078956-87078978 TGGCAACAAAGGTTTCTGGCTGG - Intergenic
1111505834 13:89186436-89186458 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1111546313 13:89741369-89741391 TGGGCACAGAGGTTTCTGGCTGG + Intergenic
1111548964 13:89783213-89783235 AGGCCACAGAGGTTTCCAGCTGG - Intergenic
1111567439 13:90033453-90033475 CAGCCACAGAGGTTTCTGGCTGG + Intergenic
1112086274 13:96034983-96035005 CAGCCATAGAGGTTTCCGGCTGG + Intronic
1112192995 13:97196129-97196151 TGCCCACAGAGGATACCAGAGGG - Intergenic
1112644793 13:101318112-101318134 TGGCTACAGAGGTTTCCGGCTGG - Intronic
1113123198 13:106946961-106946983 AGGCCACATAGCTGTCCAGCAGG - Intergenic
1113229499 13:108196152-108196174 CAGCCACAGAGGTTTCTGGCTGG + Intergenic
1113503243 13:110794499-110794521 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1113608308 13:111626009-111626031 TGGCCCAAGAGGTATCCAGCAGG + Exonic
1113643846 13:111978297-111978319 TGGCCACAGAGTTTTCCTTTGGG + Intergenic
1114344683 14:21781996-21782018 TGGACACAGAGGTTTCGAGCTGG + Intergenic
1115059246 14:29169731-29169753 CGGCCATAGAGGTTTCTGGCTGG + Intergenic
1115185161 14:30679132-30679154 TGGCCACTGTGGTTTACAGAGGG - Intronic
1115310374 14:31973529-31973551 CAGCCACAGAGGTTTCTGGCTGG - Intergenic
1115485160 14:33902698-33902720 CGGCCACAGAGGTTTCTGGCTGG + Intergenic
1116151116 14:41144424-41144446 CGGCCACAGAGGTTTCTGGCTGG - Intergenic
1116221551 14:42095123-42095145 TAGCCATAGAGGTTTCCAGCTGG - Intergenic
1116448364 14:45038259-45038281 TGGCCACAGAGGTTTCTGGCTGG - Intronic
1116617408 14:47155788-47155810 TGGCCACAGAGGTTTCTGGCTGG + Intronic
1116789861 14:49329118-49329140 TGGCCACAGAGGTTTCTAGCTGG - Intergenic
1117285340 14:54281701-54281723 CAGCCACAGAGGCTTCCAGCTGG - Intergenic
1117412949 14:55467550-55467572 CGGCCACAGAGGTTTCCAGCTGG - Intergenic
1117823217 14:59673168-59673190 TGGCTACAGAGATTTCCAGCTGG - Intronic
1117931016 14:60840015-60840037 CAGCCACAGAGGTTTCCAGCTGG + Intronic
1118199967 14:63662805-63662827 TGGCCACAGAGGTTTCCGGCTGG - Intergenic
1118282242 14:64440128-64440150 TGGCCACAGAGATATCAAACTGG - Exonic
1118313181 14:64707645-64707667 TGGCCAGGGAGGCTTCCAGGAGG + Intronic
1118472962 14:66092772-66092794 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1118765672 14:68907974-68907996 TGGCCACACAACTTTCCAGCAGG + Intronic
1119643104 14:76329419-76329441 TGTGCACAGCTGTTTCCAGCTGG - Intronic
1120590192 14:86365051-86365073 TGGCCACGGGGGTTTCCATCTGG + Intergenic
1121233042 14:92372377-92372399 TGCCCACAGACATTTGCAGCTGG + Intronic
1121302871 14:92885836-92885858 GAGCCACTGAGGTTTTCAGCAGG + Intergenic
1121368805 14:93338174-93338196 CGGCCACAGAGGTTTCCAGCTGG + Intronic
1121405288 14:93715963-93715985 GGACCTCTGAGGTTTCCAGCTGG + Intergenic
1121527883 14:94632198-94632220 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
1122354379 14:101114306-101114328 TGGCCACTGTGCTTTCCAGGAGG + Intergenic
1123035432 14:105469974-105469996 TGGCCACAGAGGAGACCAGGTGG + Exonic
1123469652 15:20540867-20540889 TTGCAGCACAGGTTTCCAGCTGG - Intronic
1123648410 15:22459832-22459854 TTGCAGCACAGGTTTCCAGCTGG + Intronic
1123729930 15:23135853-23135875 TTGCAGCACAGGTTTCCAGCTGG - Intronic
1123748100 15:23333335-23333357 TTGCAGCACAGGTTTCCAGCTGG - Intergenic
1124280464 15:28357187-28357209 TTGCAGCACAGGTTTCCAGCTGG - Intergenic
1124302234 15:28554425-28554447 TTGCAGCACAGGTTTCCAGCTGG + Intergenic
1125113912 15:36066842-36066864 CAGCCACAAAGGGTTCCAGCTGG - Intergenic
1125718318 15:41832330-41832352 TGGCCACAGAGGTTTCCAGCTGG + Intronic
1125862231 15:43009565-43009587 TGGCCACAGAGGTTTCTGGCTGG + Intronic
1126101883 15:45122939-45122961 TGGCCAAAGTGGTGTCCATCGGG + Exonic
1129183700 15:73892803-73892825 TGTCCACACAGGTTTCAAGCTGG + Intergenic
1129377590 15:75143960-75143982 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1129404041 15:75302547-75302569 TGGCCACATAGGAGTCCACCAGG + Intergenic
1129458908 15:75690161-75690183 GGTCCACGGAGATTTCCAGCCGG + Exonic
1129477050 15:75792575-75792597 TGGCCACATAGGAGTCCACCAGG + Intergenic
1129591236 15:76916677-76916699 CAGCCGCAGAGGTTTCCAGCTGG + Intergenic
1129756248 15:78101020-78101042 TGGGCACAGAGGGGTCCGGCAGG + Exonic
1130578856 15:85117090-85117112 TTTCCCCTGAGGTTTCCAGCTGG - Intronic
1131568165 15:93505542-93505564 TGGCCACAGAGGCTTCCAGCTGG - Intergenic
1131999084 15:98162072-98162094 CAGCCACATAGGTTTCCACCTGG - Intergenic
1132093019 15:98960860-98960882 CGGCCACTGGGCTTTCCAGCCGG - Exonic
1132207078 15:99993607-99993629 AGGCCCCAGATCTTTCCAGCTGG + Intronic
1132379962 15:101359465-101359487 TGGTTACAGAGGGTTCCAACTGG + Intronic
1133118522 16:3592091-3592113 GGGCCACAGAGCCTTCAAGCAGG - Intronic
1136578876 16:31140325-31140347 AGGACACAGAGGGTTCCAGGGGG + Exonic
1137344005 16:47637492-47637514 CAGCCACAGAGGTTTCTGGCTGG + Intronic
1137588800 16:49680884-49680906 TGGCCACAGAGGTTTCTGGCTGG + Intronic
1137698370 16:50478082-50478104 TGGCCACAGAGGTTTCCAGCCGG - Intergenic
1138022502 16:53497316-53497338 TGGTCACCGAGGTCTGCAGCTGG - Intronic
1138998411 16:62479291-62479313 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
1138998668 16:62481743-62481765 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1139011877 16:62644710-62644732 TGGCTAGAGAGATTTCCAGCAGG + Intergenic
1139015620 16:62685178-62685200 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1139138682 16:64234514-64234536 TGGTCACAGAGGTTTCCAGCTGG + Intergenic
1139151100 16:64382326-64382348 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1139254486 16:65527976-65527998 AGGGCACAGAGGCTTCAAGCTGG + Intergenic
1139463480 16:67141427-67141449 CGGCCAAAGTAGTTTCCAGCTGG - Intronic
1139625664 16:68186934-68186956 TAGCCACAGGGGTTTTCGGCTGG - Intronic
1140103639 16:71939413-71939435 CGGCCACAGAGGTTTCTGGCTGG + Intronic
1144390120 17:14785257-14785279 CAGCCACAGATGTTTCCAGCTGG + Intergenic
1144553464 17:16261314-16261336 TGGCCACAGAGGTTTCTAGCTGG + Intronic
1146087092 17:29839377-29839399 TGGCCACAGAGGTTTCTGGCTGG + Intronic
1146359336 17:32160932-32160954 TGGCCACAGAAGTTTCCAGTTGG + Intronic
1147684318 17:42277485-42277507 CAGCCACAAAGGTCTCCAGCTGG + Intergenic
1147901644 17:43790369-43790391 TAGCCACAGAGGTTTCTGGCTGG - Intergenic
1148115468 17:45172420-45172442 TGGGCACAGGAGTTTCCACCTGG - Intergenic
1148644192 17:49210099-49210121 TGACCAGAGAGGTTGCCAGAGGG - Intronic
1149066915 17:52491606-52491628 TGCCCCCAGATGTTTCAAGCAGG + Intergenic
1149169638 17:53793309-53793331 TGCCCACAGAGGTTTCCAGCTGG + Intergenic
1149309978 17:55384241-55384263 TGTCCAAAGAGGTTTTCAGGAGG - Intergenic
1149934634 17:60792525-60792547 TGGCCACAGAGGTTTCCGGCTGG + Intronic
1150105196 17:62457612-62457634 TGGCCCCAAAGGCATCCAGCTGG - Intergenic
1150201352 17:63361219-63361241 CAGCCACAGAGGTTTCTGGCTGG - Intronic
1150226007 17:63524743-63524765 TGGCCACAGAGGTCTTCAGGAGG - Intronic
1150521191 17:65867394-65867416 TGGCCACAGAGGTTTCTGGCTGG + Intronic
1151221112 17:72613781-72613803 TGGCAACAGAGGTCTAGAGCTGG - Intergenic
1152530623 17:80916611-80916633 CAGCCACAGAGGTTTCTGGCTGG + Intronic
1152723242 17:81933043-81933065 AGACCACAGAGATTTCCAGTGGG + Exonic
1152856553 17:82667976-82667998 CAGCCACAGAGGTTTCCAGCCGG - Intronic
1152864053 17:82711747-82711769 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1152926319 17:83089347-83089369 TGGCCACAGAGGTTTCCCGTCGG + Intronic
1153427823 18:4986675-4986697 TAGCCACAGAGGTTTCTGGCTGG - Intergenic
1153724133 18:7937607-7937629 TGGCCACAGAGGTTTCTGGCTGG + Intronic
1154084340 18:11288034-11288056 TGGACACAGGACTTTCCAGCGGG + Intergenic
1154384033 18:13877402-13877424 TGGTAACAGAGGTCTCCAGTTGG - Intergenic
1155215922 18:23642647-23642669 TAGCCATGGAGGTTTCCAGCTGG + Intronic
1157006276 18:43588830-43588852 TGGTCACAGAGGTTTCCAGCTGG - Intergenic
1157042752 18:44060212-44060234 TGGCCACAGAGGTTTCCAGGTGG - Intergenic
1157412931 18:47479015-47479037 GGGCCACGGTGGCTTCCAGCAGG - Intergenic
1158139292 18:54240769-54240791 TAACCACAGAGGTTTCCAGCTGG - Intergenic
1158774243 18:60556679-60556701 TGGCCACAGAGGTTTTGAGCTGG + Intergenic
1158788179 18:60740750-60740772 TGGCCACAGAGGTTTCCGGCTGG + Intergenic
1158889007 18:61855835-61855857 TGGCCACAGAGGTTTCCGGCTGG + Intronic
1159161192 18:64645798-64645820 TGGCCACAGAGCTTTCCAGCTGG - Intergenic
1159292567 18:66440736-66440758 TGGCCACAGAGGTTTCCGGCTGG + Intergenic
1159458698 18:68694637-68694659 TGGCCACAGAGGTTTCTGGCTGG + Intronic
1159704708 18:71673618-71673640 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
1159774155 18:72584801-72584823 TGCCCACAGAGGTTTCTGACTGG - Intronic
1160116472 18:76084093-76084115 CAGCCACAGAAGTTTCCAGCTGG - Intergenic
1160900420 19:1425111-1425133 AGGCCACAACGGGTTCCAGCAGG - Intronic
1161006419 19:1939397-1939419 TGGCCACGGTGGTTTACACCTGG + Intergenic
1161373153 19:3924918-3924940 TGACCACAGAGGCTGCGAGCAGG - Exonic
1161708006 19:5831268-5831290 TGGCCACCGAAGACTCCAGCAGG + Exonic
1161710254 19:5843679-5843701 TGGCCACAAAGGACTCCAGCAGG + Exonic
1163035417 19:14566542-14566564 CTGCCACTGAGGTTTCTAGCCGG - Intronic
1163771276 19:19192655-19192677 TGCCCACAGATTTTTCCAGAGGG - Intronic
1163948222 19:20560400-20560422 TGGCCACAGAGTATTCCATGAGG - Intronic
1164302146 19:23972062-23972084 TAGCCACAGATTTTTCCAGCGGG + Intergenic
1164418171 19:28063312-28063334 TGGTTACAGAGGTTCCCATCAGG - Intergenic
1164648400 19:29874943-29874965 TGGCTGCGGAGGATTCCAGCAGG + Intergenic
1164984584 19:32638977-32638999 CAGCCACAGAGGTTTCCGGCTGG + Intronic
1165898441 19:39156776-39156798 TGGACAGACAGGCTTCCAGCTGG - Intronic
1166908005 19:46127855-46127877 TGGCCACAGAAGTTTCTGGTTGG + Intergenic
1168137448 19:54360818-54360840 TGGCCACAGAGGACAGCAGCTGG + Intronic
1168303498 19:55420301-55420323 TGGCAACAGAGGTTTCCAGCGGG + Intergenic
1168630009 19:57949316-57949338 CGACCACAGAGGTTTCTGGCTGG - Intergenic
925007005 2:451552-451574 TGGCCACAGACGCTCCCACCAGG + Intergenic
925376427 2:3389205-3389227 CGACCACGGAGGTCTCCAGCTGG - Intronic
925515463 2:4675680-4675702 TGGTCACAGAGATTTCTGGCTGG + Intergenic
926000925 2:9331837-9331859 TGGTCACAGTGGTTTCCAGCAGG - Intronic
926161769 2:10494686-10494708 TGGCCACAGAGCCTTGCAGGTGG + Intergenic
926546361 2:14245267-14245289 CAGCTACAGAGGTTTCCAGCTGG + Intergenic
926572885 2:14548774-14548796 TGCTCTGAGAGGTTTCCAGCTGG - Intergenic
927576759 2:24207365-24207387 TGTCCACAGAGGGTCCCAGGAGG + Intronic
927886377 2:26721198-26721220 TGTCCACAGAGGAGTCCTGCAGG - Intronic
928182556 2:29079868-29079890 TAGCCACAGAGGTTTCCAGCTGG - Intergenic
928470122 2:31567780-31567802 TGGCCACAGAGGTTTCCAGCTGG - Intronic
928796853 2:35033777-35033799 CAGCCACAGAGGTTTCTGGCTGG - Intergenic
928840621 2:35600136-35600158 TGCCCACAGAGGTTTCCAGCTGG + Intergenic
928854613 2:35789309-35789331 TGACCACAGATGGTTTCAGCTGG + Intergenic
929014719 2:37482599-37482621 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
929736541 2:44555910-44555932 TGGCCAGAGAGGCTTCCAGCAGG + Intronic
929846974 2:45540945-45540967 TGGCCACAGAGGTGTCTGGCTGG - Intronic
930119001 2:47744436-47744458 CAGCCACAGAAGTTTCCAGCTGG + Intronic
930313491 2:49770996-49771018 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
930729170 2:54710554-54710576 TGGCCACAGAGGTTTCTGGATGG + Intergenic
931005676 2:57848761-57848783 TGACCACAGAGTTTTCCTGCTGG - Intergenic
931300667 2:60974937-60974959 TGTCCACAGAGGTTTCCAGCTGG + Intronic
931324602 2:61206447-61206469 AAGCCAAAGAAGTTTCCAGCTGG + Intronic
931733678 2:65175868-65175890 TGACCACAGAGGTTTCTGGCTGG - Intergenic
932054559 2:68431673-68431695 TGGCCACAGAGGTTTCCAGCAGG - Intergenic
932398100 2:71462031-71462053 CAGCCACAGAGGTTTCCAGCTGG - Intronic
932803568 2:74764255-74764277 TGGCCCCAGAGCTACCCAGCAGG + Intergenic
932960448 2:76406851-76406873 TGGCCACAGAAGTTTCCAGCTGG + Intergenic
932972612 2:76563814-76563836 TGGCCACAGAGATTTTTGGCCGG - Intergenic
933455061 2:82509033-82509055 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
933606383 2:84388981-84389003 CAGCCACAGATGTTTCCAGCTGG - Intergenic
934934409 2:98454242-98454264 AAGGCACAGAGGATTCCAGCGGG - Intronic
937163882 2:119794258-119794280 TGGCCACAGAGGTTTCCAGCTGG - Intronic
937737981 2:125314209-125314231 TGGCCACAAAGATTTCTGGCTGG + Intergenic
937914051 2:127090278-127090300 TGGCCACAGCGGGTTGCACCAGG - Intronic
938721946 2:134075316-134075338 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
939017480 2:136919628-136919650 TGGCCACAGAGGTTTCTGGCTGG - Intronic
939084757 2:137706844-137706866 TGGCCACAAAGGTTTCTGGCTGG - Intergenic
939466555 2:142563244-142563266 CGGCCACAGAAGTTTCTAACTGG + Intergenic
939490236 2:142868264-142868286 CAGCCACAGAGGTTTTCAGCTGG - Intergenic
939670956 2:145011737-145011759 TGTCCACTGAGGATTTCAGCAGG + Intergenic
939802054 2:146721820-146721842 GGGTCACAGAGGTTTCCAGCTGG + Intergenic
939917776 2:148068587-148068609 TTGCCACAGAAGTTACCTGCTGG - Intronic
939926002 2:148173574-148173596 TAGCCACAGAGGTTTCTGGCTGG + Intronic
939989829 2:148867108-148867130 TGATTACAGAGGTTTCCATCTGG - Intergenic
940130024 2:150370287-150370309 TGGTCATGGAGGTCTCCAGCTGG + Intergenic
940246542 2:151624458-151624480 TGGCCACAGAGCTTCTCAGTTGG - Intronic
940398518 2:153221537-153221559 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
940422632 2:153498290-153498312 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
940582425 2:155599840-155599862 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
940694123 2:156958443-156958465 TGGCCACAGAGATTTCCAGCTGG - Intergenic
940956800 2:159737910-159737932 CAGCCACAGAGGCTTCTAGCTGG - Intronic
941043778 2:160650029-160650051 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
941106141 2:161355587-161355609 TGATCTCAGAGGTTTCCAGATGG - Intronic
941131218 2:161651935-161651957 TGGCCACAGAGGCTTCTGGCTGG + Intronic
941151554 2:161920237-161920259 TGGCCACAAAGGCTTCTGGCTGG + Intronic
941432475 2:165428064-165428086 CAGCCACAGAGGTTTCTAGCTGG + Intergenic
941929017 2:170923045-170923067 TGATCACAGAGGTTTCCAGCTGG - Intergenic
941999026 2:171627770-171627792 TAGCCACAGAGGTTTCTGGCTGG + Intergenic
942444421 2:176068532-176068554 TGGGCAGCGAGGTTTCCAGCCGG + Intergenic
942867894 2:180698704-180698726 CAGCCACAGAGGTTTCTGGCTGG - Intergenic
943064258 2:183070117-183070139 CGACCACAGAGGTTTACAGCTGG + Intergenic
943129482 2:183838604-183838626 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
943191187 2:184681206-184681228 TGGCCACAGAGGTTCCCAGATGG + Intronic
943191343 2:184682266-184682288 TGGCCAAAGAGGTTTCCAGCTGG + Intronic
943224114 2:185145834-185145856 CTGCCACAGAGGTTTCTAGCAGG + Intergenic
943226564 2:185185709-185185731 TGGTCACAGAGGATTCAGGCTGG + Intergenic
943241923 2:185396528-185396550 CAGCCACAGAGATTTCTAGCTGG - Intergenic
943858576 2:192829305-192829327 TGGCCACAGAGGTTTCCGGCTGG + Intergenic
943932313 2:193869119-193869141 CAGCCACAGAGGTTTCTGGCTGG + Intergenic
943981589 2:194559592-194559614 TGGTCACAGAGATTTCTGGCTGG - Intergenic
944146908 2:196515397-196515419 CGGCAACAGAGGTTTCCAGCTGG + Intronic
944391956 2:199227291-199227313 TGGCCACAGATGGTTTCTGCTGG - Intergenic
945721478 2:213422581-213422603 CAGCCACAGAGGTTTCTGGCTGG + Intronic
945770264 2:214034408-214034430 TGGCCATGGAGGTTTCCAGCTGG - Intronic
945871041 2:215226685-215226707 TGGCCCAAGAGTTTTCCAGCTGG + Intergenic
948112779 2:235470359-235470381 TTGCCACATTGCTTTCCAGCTGG + Intergenic
948293536 2:236844876-236844898 TGGCCACAGAGGTTTCCGGCCGG - Intergenic
948334775 2:237199582-237199604 CAGCCACAGAGGTTTCTGGCTGG - Intergenic
948713334 2:239839595-239839617 TGGCCGCAGAGGTTTCTGGCTGG + Intergenic
948782056 2:240327873-240327895 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
948837103 2:240631161-240631183 TGGCCAGAGTGGGTTCCTGCTGG + Exonic
1168983268 20:2026013-2026035 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
1169309489 20:4522632-4522654 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1169436374 20:5595728-5595750 TTTCAACAGAGGTTTCCAGGTGG + Intronic
1169632210 20:7646761-7646783 CAGCCACAGAGGTTTCTGGCTGG - Intergenic
1169880659 20:10342533-10342555 TGGCCACAGATGTTCCCAGCTGG + Intergenic
1170221708 20:13948075-13948097 CAGCCACAGAGGCTTCCAGCTGG + Intronic
1170314773 20:15030880-15030902 CAGCCTCAGAGGTTTCCGGCTGG - Intronic
1170458528 20:16555090-16555112 TGGCCACAAAGGTTTCCAGCTGG + Intronic
1171785229 20:29457883-29457905 TGGCAACAGTGGTATCCAGCAGG + Intergenic
1172775851 20:37406524-37406546 TGGGCACCGAGGTGTGCAGCTGG + Intergenic
1172778166 20:37420102-37420124 AGGCCACAGAGGAAGCCAGCAGG - Intergenic
1172880040 20:38193901-38193923 TTGCCACTGAGGCCTCCAGCGGG - Intergenic
1173207447 20:41006186-41006208 TGGCTACAGAGGTTTCTGGCTGG - Intergenic
1173303841 20:41829078-41829100 CGGCCACAGAGATTTTCAGCTGG + Intergenic
1173656004 20:44700775-44700797 TGGCCACAGTGGCTGCCAGCAGG - Intergenic
1174668413 20:52282689-52282711 TGGCCACATAGATTTCCTGCAGG + Intergenic
1174918837 20:54680943-54680965 TGACCACAGAGGTTAGCTGCCGG - Intergenic
1175138707 20:56843744-56843766 GGGCCACAGAGATTTCAAGCTGG + Intergenic
1175312723 20:58023304-58023326 TGGTCACAGAGGTTTCCGGCTGG - Intergenic
1175890379 20:62313340-62313362 TGTCCACAGCCGTGTCCAGCTGG + Exonic
1176088215 20:63307563-63307585 TGGCCACAGTCACTTCCAGCAGG + Exonic
1176104767 20:63380786-63380808 CGGCCACAGAGGCTTCCAGCAGG + Intergenic
1176875852 21:14126829-14126851 TGGGCACAGTGGTTGCCAGCAGG + Intronic
1176973107 21:15289212-15289234 TGGCCACAGAAGTTCCCGGCTGG - Intergenic
1176992968 21:15521255-15521277 TGGCCACAGAGTTTACTGGCTGG - Intergenic
1177012088 21:15742740-15742762 TGGCCTTAGAGGTTTCTTGCTGG - Intronic
1177125795 21:17191913-17191935 TAGCCACAGAGCTTTCCTGCTGG + Intergenic
1177262743 21:18750931-18750953 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
1177265284 21:18775164-18775186 TGGCAGCAGAGGTCTCCAGCTGG + Intergenic
1177357638 21:20030462-20030484 TGGCTACAGAGGTTTCCAGCTGG - Intergenic
1177404476 21:20646811-20646833 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1177624728 21:23645692-23645714 AGACCACAAAGGTTTCCAACTGG - Intergenic
1177687426 21:24456459-24456481 TGACCACAGAGGTTTCTGGCTGG - Intergenic
1177716605 21:24846911-24846933 TGGCCACAGTGGGCTCCAGTGGG - Intergenic
1178019753 21:28395166-28395188 TGACCACAGATGGTTTCAGCTGG + Intergenic
1178354756 21:31901293-31901315 TGGTCACTGAGGTTTGCAGAGGG + Intronic
1178937583 21:36876267-36876289 CAGCCACAGAGGTTTCTGGCTGG + Intronic
1178947527 21:36960309-36960331 TAGCCACAGAGGTTTCTGTCTGG + Intronic
1179180783 21:39043096-39043118 TGGTCATGGAGGTTTGCAGCAGG - Intergenic
1179342470 21:40525818-40525840 AGGCCACAGGGGTTTTCAGTAGG - Intronic
1179407516 21:41137707-41137729 CGACCACAGAGGTTTCCAGCTGG + Intergenic
1179707730 21:43192001-43192023 TGGTGAGAGAGGTCTCCAGCAGG - Intergenic
1179921441 21:44509702-44509724 TGGCCAAGGAGGCTGCCAGCAGG - Intronic
1180251743 21:46594670-46594692 TGGCTAAAGAAGCTTCCAGCTGG + Intergenic
1181459830 22:23079355-23079377 TGGACAAAGAGTTTTCCAGGAGG + Intronic
1181891182 22:26065012-26065034 TGGCCAAAGCGGGTTCAAGCTGG - Intergenic
1182416787 22:30226484-30226506 TGGACACATGGGTTTCCAGGGGG - Intergenic
1183024831 22:35057331-35057353 TGGGCCCAGTGGTTTCCAGCTGG - Intergenic
1183963301 22:41425921-41425943 AAACCACAGAGGTTTCCAGAAGG - Intergenic
1184886909 22:47352079-47352101 TGCCCAGAGAGGTCACCAGCTGG - Intergenic
1185063256 22:48618066-48618088 TGGACACGGAGGTTAACAGCAGG + Intronic
1185373672 22:50472236-50472258 TTTCCTGAGAGGTTTCCAGCTGG + Intronic
949218402 3:1600209-1600231 TGGCCACAGAGCTTTCTGGCTGG - Intergenic
949226517 3:1701002-1701024 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
950207764 3:11093532-11093554 TGGCCACAGAGGTTTCCAGCCGG + Intergenic
950664593 3:14487658-14487680 GGGCCACAGAGATTTCCTGACGG + Exonic
950884188 3:16348488-16348510 TGGACACAGTGGGCTCCAGCTGG - Intronic
950994634 3:17481419-17481441 CTGCCACAGAGGTTTCCAGCTGG + Intronic
951465483 3:22996708-22996730 TGGCCCCAGAGGTTGGAAGCAGG + Intergenic
951509519 3:23485991-23486013 TGGTCATAGACGTTTCCAGCTGG - Intronic
951566657 3:24018783-24018805 CAGCCACAGAGGTTTCTGGCTGG - Intergenic
951718305 3:25672904-25672926 TGACCACAGAGGTTTCCGGCTGG - Intergenic
952303257 3:32123176-32123198 TGGACACAGTGGCTTCCACCTGG - Intronic
952793495 3:37218557-37218579 TGGCCTCAGAAGTTTCCAGCTGG + Intergenic
953603205 3:44387781-44387803 CAACCACAGAGGTTTCCAGCTGG + Intronic
953748029 3:45590196-45590218 TAGCCACAGAGGTTTCTGTCTGG - Intronic
954840370 3:53506287-53506309 TGGGCACAGGGGTGTCCAGAGGG - Intronic
955111731 3:55957499-55957521 TGGCCACAGAGGTTTCCAGCTGG - Intronic
957156646 3:76552029-76552051 CAGCCACAGAGGTTTCCGGCTGG + Intronic
957223657 3:77415517-77415539 TGGCCACAGAGATTTCTGGCTGG - Intronic
957307918 3:78481400-78481422 TGGCCACAGAGGTTTTCAGCTGG + Intergenic
957418052 3:79930510-79930532 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
957486818 3:80871930-80871952 GGGCCACAGAGGTTTCTGGCTGG + Intergenic
957614641 3:82510481-82510503 AAGCCACAGACGCTTCCAGCTGG + Intergenic
957665023 3:83216923-83216945 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
958019518 3:87979595-87979617 TGGCCACAGAGGCTTCTGACTGG - Intergenic
958161075 3:89817784-89817806 CAGCCACACAGGTTTCCAGCTGG - Intergenic
958677942 3:97291849-97291871 TGGCCACAGAGGTTTCCGGCTGG - Intronic
959327535 3:104956607-104956629 CAGCAACAGAGGTTTCCAGCTGG - Intergenic
959355054 3:105316040-105316062 TGGCAGGAGAGATTTCCAGCAGG + Intergenic
960010986 3:112834596-112834618 TGGCCACAAAGGTTTCCAGCTGG - Intronic
961311552 3:126005018-126005040 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
961420152 3:126796802-126796824 TGGCCACAGAGGCTTCGAGTGGG - Intronic
961942825 3:130655763-130655785 TGGCCACAGAGGTTTCCAGCTGG - Intronic
962763646 3:138541963-138541985 TGGCCACAGAGGTTTCTGGCTGG - Intronic
963006607 3:140732182-140732204 GCGCCACAGAGGGTTCCAGTGGG + Intergenic
963250357 3:143096713-143096735 TGGCCACAGAGGTTTCCTGCTGG + Intergenic
963403634 3:144834923-144834945 TGGCCACAGAAGTTTCTGGCTGG + Intergenic
963447155 3:145427429-145427451 CGGCCACAGAGATTTCTGGCTGG - Intergenic
963642389 3:147876732-147876754 TGGCCACAGAGATTTCTGACTGG - Intergenic
964075025 3:152683577-152683599 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
965008769 3:163058509-163058531 TGGGCACAGTGGGTTCCAGTGGG - Intergenic
965009945 3:163074308-163074330 CAGCCACAGAGGTTTCTGGCTGG + Intergenic
965016743 3:163168003-163168025 CAGCCACAGGGGTTTACAGCAGG - Intergenic
965056286 3:163721538-163721560 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
965061186 3:163787631-163787653 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
965073845 3:163952561-163952583 TAGCCACAGAGGTTTCCTGATGG - Intergenic
965433443 3:168617808-168617830 TAGCCACAGCTGTCTCCAGCAGG + Intergenic
965924154 3:173957768-173957790 TGGCTACGGAGGTTTCTGGCTGG - Intronic
966254360 3:177900074-177900096 TGTCCACAGAGGTTTCTGGCTGG + Intergenic
968448322 4:663535-663557 TGGCCTCAGAGGTCACCACCGGG - Intronic
968695719 4:2025313-2025335 TGGCCACAGAGGTTTCCAGCTGG + Intronic
968838176 4:2980772-2980794 TGGCCACAGAAGTCTCCAGCTGG - Intronic
969415371 4:7054247-7054269 CAGCCACAGAGATGTCCAGCGGG - Exonic
970256970 4:14178337-14178359 TTGTCACAGAAGTTTCAAGCTGG - Intergenic
970475467 4:16417689-16417711 TGCCCACAAGGGGTTCCAGCAGG - Intergenic
970709185 4:18842417-18842439 TGGCCATAGAGGTTTCCAGCTGG - Intergenic
970959814 4:21858232-21858254 TGGCCACAGAAGTTTCCAGCTGG + Intronic
971834582 4:31747606-31747628 TCGCCACAGAGGTTTCCAGCTGG - Intergenic
971876699 4:32318042-32318064 TGGCCACAGAAGTTTCCGACTGG - Intergenic
971948839 4:33316653-33316675 CAGTCACAGAGATTTCCAGCTGG - Intergenic
972075466 4:35080389-35080411 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
972106621 4:35495380-35495402 TGGCCACGGAGGTTTCTGGCTGG + Intergenic
972245769 4:37244499-37244521 TGTCCACAGAGGAGTCCAGGAGG + Exonic
972788353 4:42347426-42347448 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
973534376 4:51866858-51866880 CAGCCACAGAAGTTTCCGGCTGG - Intronic
973834475 4:54795654-54795676 TGGCTACACTGGTTTCTAGCTGG - Intergenic
974178835 4:58359544-58359566 CAGCCACAGAGGCTTCCAGCTGG - Intergenic
974227028 4:59060133-59060155 CAGCCACAGAAGTCTCCAGCTGG - Intergenic
974521469 4:62986778-62986800 CAGCCACAGAGGTTTCTGGCTGG - Intergenic
974551514 4:63380447-63380469 CAGCCATAGAGGTTTCCAGCTGG + Intergenic
974564213 4:63563387-63563409 TAGCTGCAGAGATTTCCAGCTGG - Intergenic
974629042 4:64458782-64458804 TGGCCACAGAGGTTTTCAGCTGG + Intergenic
974683347 4:65194004-65194026 CAGCCACAAAGGTTTTCAGCTGG - Intergenic
974698068 4:65399481-65399503 TGGCCACAGAGGCTTCTGCCTGG + Intronic
974761668 4:66284957-66284979 CGGCCACAAAGGTTTCCAGGTGG - Intergenic
975040722 4:69742626-69742648 TGGCCACAGAGGTTTCCGGCTGG - Intronic
975254205 4:72215241-72215263 TGGCCACAGAGGTTGCCAGCTGG - Intergenic
975416667 4:74112688-74112710 CAGCCACAGAGATTTCCAGCTGG + Intergenic
975498465 4:75058852-75058874 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
976129874 4:81872254-81872276 CAGCCACAGAGGTTTCCCGCTGG + Intronic
976342746 4:83963587-83963609 TGACCACAGATGTTTTCAGCTGG - Intergenic
976922534 4:90456879-90456901 CAGCCACAGAGATTTCTAGCTGG - Intronic
977487187 4:97664759-97664781 TGGCCACAGAGGTTTCTGGCTGG - Intronic
977645773 4:99410157-99410179 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
978061669 4:104346179-104346201 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
978149204 4:105414327-105414349 TGGCCACAGAGGTTTCCAGCTGG - Intronic
978248415 4:106603402-106603424 TGGCCATAGAGGTTTCTGGCTGG - Intergenic
978300899 4:107269179-107269201 TGGCTAGAGAGGTTTCCAGCTGG - Intronic
978347496 4:107787706-107787728 CAGCCACAGAGGTTTCTGGCTGG - Intergenic
978466887 4:109017419-109017441 TGGCCACAAAGGTTTCCAGCTGG + Intronic
978472052 4:109079249-109079271 TGTCCAGACAGATTTCCAGCTGG + Intronic
978498637 4:109385561-109385583 TGGCCACAGAGGTTTCTAGCTGG + Intergenic
978663282 4:111153687-111153709 TGGCCACAGAGATTTCTGCCTGG - Intergenic
978822125 4:112979042-112979064 TGACCACAGAGGTTTCCGGCTGG - Intronic
978944081 4:114472957-114472979 CAGCCACAGAGGTTTCCGGCTGG + Intergenic
979010938 4:115366777-115366799 TGGCCAAAGAGGATTCCTGCTGG + Intergenic
979637722 4:122977160-122977182 CGGCCACAGAGGTTTCTGGCTGG - Intronic
979648813 4:123106723-123106745 TGGCCATGGAGGTTTCCAGCTGG - Intronic
979946951 4:126843939-126843961 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
979956298 4:126956820-126956842 TGGCCACAGAGGTTTCCGGCTGG + Intergenic
980253476 4:130348509-130348531 CAGCCATAGAAGTTTCCAGCCGG - Intergenic
980282502 4:130738531-130738553 AAGCCACAGAGGTTTCTGGCTGG + Intergenic
980306118 4:131063929-131063951 TGGCCACAGAGGTTTCCGGCTGG - Intergenic
980308585 4:131099017-131099039 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
980450364 4:132960747-132960769 TGGCCACAGATGTTTGTGGCTGG + Intergenic
980480917 4:133385755-133385777 TGGCCACAGAGGTTTCCGGCTGG + Intergenic
980574245 4:134665455-134665477 TGGCCACAGATGTTTCCATCTGG - Intergenic
980582852 4:134775138-134775160 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
980730808 4:136823014-136823036 TGGACACAGAAGTTTACAGCTGG - Intergenic
980768889 4:137345891-137345913 TGGTCAGAGATGTTTCAAGCTGG + Intergenic
981889054 4:149715110-149715132 CAGCCACAGAGGTTTCTGGCTGG - Intergenic
982494755 4:156077172-156077194 TGGCCACAAAGATTTCCAGCTGG - Intergenic
982545360 4:156725574-156725596 TGGCCAAAGAGGTTTCCAGCTGG + Intergenic
982611217 4:157575705-157575727 TGGCCACATAGGTTTCCAGCTGG + Intergenic
982802448 4:159722076-159722098 TGGCCACAGAGGCTTCTGCCTGG - Intergenic
982856075 4:160384756-160384778 TGGCCACAGAGGTTTTAGGCAGG - Intergenic
982900889 4:161002390-161002412 TGGCCACAGATATTTCTGGCTGG - Intergenic
982957858 4:161793334-161793356 TGGCAACAGAGGTTTCCAGCTGG + Intronic
983000421 4:162408276-162408298 TGGCCACAGAGGTTTCTGACTGG - Intergenic
983069568 4:163253264-163253286 TGGCCACAGAGGCTTCTGGCTGG - Intergenic
983125700 4:163948999-163949021 TGGCCACAGAGATTTCCCACTGG - Intronic
983323931 4:166228464-166228486 CAGCCACAGAGGTTTCCTGCTGG + Intergenic
983352064 4:166602430-166602452 CAGCCACAGAGGTCTCCAGCTGG + Intergenic
983379956 4:166980433-166980455 CAGCCACAGAGGTTTCATGCTGG - Intronic
983431160 4:167652617-167652639 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
983472582 4:168174611-168174633 CAGCCACAGAGGTCTCCAACTGG + Intronic
983715600 4:170777345-170777367 TGGCCGCAGAGGTTTCTGGCTGG + Intergenic
984169289 4:176342412-176342434 CAGCCACAGAGGTTTCTGGCTGG - Intergenic
984296824 4:177863037-177863059 CGGCCACAGAGGTTTCCAGCTGG + Intronic
984338002 4:178416281-178416303 CGGCCACACAGGTTTCCAGCTGG + Intergenic
984526559 4:180865796-180865818 TGGTCACAGAGGTTTCAAGCTGG - Intergenic
985680194 5:1252090-1252112 TGGCTCCAGAGCCTTCCAGCAGG - Intergenic
986923660 5:12718302-12718324 TGTCCACAGAGGCTTCCTACTGG + Intergenic
986947600 5:13043681-13043703 TGCCCTAAGAAGTTTCCAGCTGG - Intergenic
987181529 5:15372940-15372962 TGGCCACAGAGGCTCTCGGCTGG + Intergenic
987875549 5:23675780-23675802 TGGCCACAGCAGTTTCTTGCTGG + Intergenic
987999732 5:25332033-25332055 TGGCCACAGAGATTTCTGGCTGG + Intergenic
988073332 5:26323854-26323876 TGACCGCAGAGGTTTCTGGCTGG - Intergenic
988081017 5:26415932-26415954 CGGCCACAGAGGTTTCTGGCTGG - Intergenic
988110090 5:26808185-26808207 TGGCCACAGAGATATTGAGCTGG + Intergenic
988202449 5:28084394-28084416 CAGCCACAGAGGTTTCCACCTGG + Intergenic
988216831 5:28286175-28286197 GGGGCACAGAAGTTCCCAGCTGG + Intergenic
988409265 5:30865184-30865206 TGCCGACAGTGGTTTCCATCTGG - Intergenic
988940537 5:36140448-36140470 TGGCCATAGAGGTTTCCAGCTGG + Intronic
989520823 5:42397549-42397571 TGGCCACAGAGGTTTCTGACTGG + Intergenic
989718379 5:44493116-44493138 CAGCCACAGAGGTTTCCAACTGG + Intergenic
989821842 5:45801579-45801601 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
990878929 5:60518339-60518361 TAGCCACAAAGGTTTCTGGCTGG + Intronic
991039516 5:62161634-62161656 CAGCCACAGAGGTTTCTGGCTGG - Intergenic
991359111 5:65802094-65802116 TGGTCACAGAGGTTTCTGGCTGG - Intronic
992029539 5:72708113-72708135 TGGCCACAGAGATTTCCAGTTGG - Intergenic
992692959 5:79258392-79258414 TGGCCACACAAGTTTCTGGCTGG - Intronic
992838762 5:80667422-80667444 CAGCCACAGAGGTTTACAGCTGG - Intronic
993211712 5:84961202-84961224 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
993227258 5:85182704-85182726 TGGCCGCAGAGATTTCCAGCTGG + Intergenic
993703206 5:91142865-91142887 TGGCCACAGAGATTTCCAGCTGG - Intronic
994239531 5:97405619-97405641 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
994406416 5:99351677-99351699 CAGCCACAGAGGTTTCCAGTTGG - Intergenic
994451704 5:99951539-99951561 TGGCCACAGAAGTTTCCGGCTGG + Intergenic
994451948 5:99955022-99955044 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
994518113 5:100795148-100795170 TGGACACAGAGGTTTCCACCTGG + Intergenic
994873954 5:105392001-105392023 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
994891462 5:105640672-105640694 CGGCCACAGAGATTTCCAGCTGG + Intergenic
995024701 5:107406439-107406461 TGGCAAGAGAGTTTTCCAGGTGG - Intronic
995146163 5:108788475-108788497 TGGCTACAGAGGTTTCTGGCTGG + Intronic
995386492 5:111595497-111595519 CGGCCACAGAGTTTTCTGGCTGG - Intergenic
995386775 5:111597071-111597093 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
995395155 5:111679662-111679684 TGGCCACCGAGATTTCTGGCTGG - Intronic
995724156 5:115167117-115167139 TTGCCACAGAGGTTTCTGGCTGG + Intronic
995742574 5:115369773-115369795 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
996684559 5:126266253-126266275 TGGCCATGGAGATTTCCAGCTGG + Intergenic
996711090 5:126544298-126544320 TGGCCTCAGAGTCCTCCAGCAGG + Exonic
997653193 5:135536982-135537004 GGGCCACAGAGGCTGCAAGCAGG - Intergenic
998480387 5:142458334-142458356 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
999124981 5:149240018-149240040 TGGCCACCCAGGTGACCAGCTGG + Intronic
999887015 5:155935729-155935751 TGGCCACAGAGGTTTCCAGCTGG - Intronic
1000266426 5:159642005-159642027 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1000472401 5:161661162-161661184 TGGCCACAGAGGTTTCCTGCTGG + Intronic
1000610221 5:163365485-163365507 CAGCCACAGAGGTCTCCAGCTGG + Intergenic
1000854015 5:166377861-166377883 CGGCCACAGAGGCTTCCAGCTGG - Intergenic
1002660292 5:180787042-180787064 TGGAGACAGAGATTTCCACCAGG + Intergenic
1002889973 6:1324000-1324022 TGGGCACAGAGGTTGCCAAAAGG - Intergenic
1003235857 6:4294753-4294775 TGGCCCCAGAGGCTGCCTGCAGG - Intergenic
1004583875 6:16980487-16980509 AAGGCACAGAGATTTCCAGCAGG + Intergenic
1004672270 6:17808775-17808797 TTGGCACTGAGGTTTGCAGCAGG + Exonic
1005521959 6:26609560-26609582 TGGGCACAGAGTATTCCAACTGG - Intergenic
1005626541 6:27667910-27667932 GGGCTACAGAGGTTTGCAGAAGG - Intergenic
1005658309 6:27966790-27966812 CGGCCACAGAGGTTTCTGGCTGG - Intergenic
1005782232 6:29203964-29203986 TAGCCACAGAGGTTTTCAGCTGG - Intergenic
1005992422 6:30911659-30911681 GAGGAACAGAGGTTTCCAGCTGG - Intronic
1006463672 6:34178356-34178378 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
1006894798 6:37460972-37460994 TGGCCAGAGAGTCTGCCAGCTGG + Intronic
1007599209 6:43071443-43071465 AGGCCACAGCGGTTCCCAGGGGG + Intronic
1008253050 6:49264583-49264605 TGGTCACGGAGGTCTCCAGCTGG - Intergenic
1009241571 6:61192550-61192572 TAGCCACAGAGGTTTCCAGCTGG - Intergenic
1009243218 6:61204084-61204106 TGGGCACAAAGGTTTTCAGCTGG - Intergenic
1009463477 6:63942283-63942305 TGGACACAGTTGTTTCCAGCAGG - Intronic
1009534171 6:64860232-64860254 TGGCCACAGAGTTTTCTGGCTGG - Intronic
1009582645 6:65557145-65557167 TGGCCACAGAGGTGTCTGGCTGG - Intronic
1009588786 6:65638874-65638896 TGGCCACAGAGGTTTCCAGCTGG + Intronic
1009645653 6:66396867-66396889 CAGACACAGAGGTTTCCGGCTGG + Intergenic
1009651254 6:66480274-66480296 TGACCACAGATGGTTTCAGCTGG - Intergenic
1010488942 6:76451926-76451948 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
1010847043 6:80721148-80721170 TGGCCACAGAGGTTTCCGGCTGG + Intergenic
1010887477 6:81262710-81262732 CGGTCACAGAGGTTCCCAGCTGG - Intergenic
1011284016 6:85705266-85705288 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
1011285120 6:85715023-85715045 CAGCCACAGAGATTTCCAGCTGG - Intergenic
1011930005 6:92700454-92700476 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
1012122517 6:95385316-95385338 TGGCGACAGAGGTTTCTGGCAGG + Intergenic
1012316748 6:97790857-97790879 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
1012696337 6:102390005-102390027 TGGCTGCAGAGGTTTCCAGCTGG - Intergenic
1012717922 6:102701049-102701071 CGACCACAGAGGTTTCCAGCTGG - Intergenic
1013438443 6:110137939-110137961 TGGCCACAGAGGTTTCCAGCTGG - Intronic
1014018750 6:116564903-116564925 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1014227021 6:118860904-118860926 CAACCACAGAGGTTTCCAGCTGG - Intronic
1014360896 6:120472021-120472043 CAGCCACAGAGATTTCCAGCTGG + Intergenic
1014392087 6:120874787-120874809 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
1014418597 6:121214264-121214286 AGGCCACACAGGTTTCCAGCTGG - Intronic
1014817777 6:125953847-125953869 TGGCCACAGGGGTTTCCAGCTGG + Intergenic
1015096060 6:129416649-129416671 TGGCCACAGAGGTTTCCAGCTGG - Intronic
1015143488 6:129959863-129959885 CGGCCATAGAGGTTTCAGGCTGG + Intergenic
1015434873 6:133173577-133173599 TGGCCACAGAGGTTTCTGACTGG + Intergenic
1016076611 6:139804191-139804213 CGGCCACAGAGGTTTCCAGCTGG - Intergenic
1016163146 6:140907229-140907251 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
1017522189 6:155212628-155212650 TGGCCACAGAGGTTTCCGGCTGG - Intronic
1019897849 7:3997184-3997206 CAGCCACAGAGGTTTCTGGCTGG - Intronic
1020658868 7:10959393-10959415 TGCCCATAGAGGTTTCCAGCTGG - Intergenic
1020761394 7:12270918-12270940 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
1020763791 7:12296605-12296627 TGGCCACAGAGATTTCCAGCTGG + Intergenic
1020812313 7:12863132-12863154 TGGTCACAGAAGTTTCTGGCTGG - Intergenic
1020832404 7:13109237-13109259 CAACCACAAAGGTTTCCAGCTGG - Intergenic
1021097404 7:16548795-16548817 TGGCCACAGAGGTTTCCAGCTGG + Intronic
1021500627 7:21329161-21329183 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
1021677826 7:23098382-23098404 TAGCCACAGAGGTTTCTGGCTGG + Intergenic
1021891371 7:25188948-25188970 TGGACACTGAGCTTTCCAGATGG - Intergenic
1022392040 7:29951457-29951479 CAGCCACAGAGGTTTCCGGCTGG + Intronic
1022688016 7:32614742-32614764 TGGCCATAGAGCTTTAGAGCTGG + Intergenic
1023529119 7:41135529-41135551 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
1024024788 7:45400948-45400970 CGGCCACAGAGGTTTCTGGCTGG + Intergenic
1024786422 7:52912136-52912158 CAGCCACAGAGGTTTCTGGCTGG + Intergenic
1024794958 7:53009015-53009037 TGGCCACAGTAGTTTCCAGCTGG + Intergenic
1024934387 7:54698154-54698176 GGCCCACAGATGTCTCCAGCAGG - Intergenic
1025115749 7:56256458-56256480 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1025842399 7:65163070-65163092 TAGCCACAGAGCTGCCCAGCAGG - Intergenic
1025880646 7:65532899-65532921 TAGCCACAGAGCTGCCCAGCAGG + Intergenic
1025892791 7:65669705-65669727 TAGCCACAGAGCTGCCCAGCAGG - Intergenic
1026200150 7:68207348-68207370 CAACCGCAGAGGTTTCCAGCTGG + Intergenic
1026370022 7:69690347-69690369 AGGCCACAGAGGTTTCCAGCTGG - Intronic
1026391775 7:69910239-69910261 CTGCCACAGAGGATTCCAGCTGG - Intronic
1027575334 7:79923308-79923330 TGACCACAGCGGTTTCCGACTGG + Intergenic
1027687236 7:81293869-81293891 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
1027924980 7:84448216-84448238 CAGCCACAGAGGTTTCTGGCTGG + Intronic
1028054391 7:86225097-86225119 CAGCCAAAGAGGCTTCCAGCTGG - Intergenic
1028111927 7:86950814-86950836 TGGCCACAGGGGTTTCCAGCTGG + Intronic
1028128796 7:87146751-87146773 CGGCCACAGAGGTTTCCGGCTGG - Intergenic
1028136920 7:87231542-87231564 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1028401775 7:90432804-90432826 CAGCCACAGAGGTTTCTGGCTGG - Intronic
1028496214 7:91463664-91463686 TGGCCATGGAGGTCTCCAGCTGG + Intergenic
1028527260 7:91800411-91800433 TGGCCACAGATGTTTCTGGCTGG - Intronic
1028596192 7:92547869-92547891 TAGCCACAGAGGTTTCTGGCTGG + Intergenic
1028640936 7:93040719-93040741 CGGCCACAGAGATTTCCGGCTGG + Intergenic
1028814903 7:95132630-95132652 CGGCCGCAGAGATTTCCAGCTGG - Intronic
1028983466 7:96992478-96992500 TTGCCACCGAGCTTTCCCGCGGG + Intergenic
1028999515 7:97138816-97138838 TGCCCACAGAGGTCCCCAGCTGG - Intronic
1030103276 7:105965220-105965242 GGGCTACAGAGGCTTCTAGCGGG + Intronic
1030199981 7:106892705-106892727 TGTCCACAGTGGTTTGCAGAGGG + Intronic
1030359611 7:108580686-108580708 CGGCCACAGAGGTTTCCAGCTGG + Intergenic
1030541557 7:110836709-110836731 GGGCCACAGAGGTTTCTAAGGGG - Intronic
1030980962 7:116185398-116185420 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
1031173863 7:118324798-118324820 AGGCCACAGAGGTCTCCAGCTGG - Intergenic
1031437113 7:121746116-121746138 TGGACACAGAGAATTTCAGCTGG - Intergenic
1031786731 7:126041859-126041881 TGGCCACAGAGATTTCTGGCTGG + Intergenic
1031921819 7:127608087-127608109 TAGCCACAGAAGTTTCCGGCTGG - Intergenic
1032590999 7:133192442-133192464 CAGCAACAGAGGTTTCCAGCTGG - Intergenic
1032591048 7:133192934-133192956 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
1032658179 7:133954628-133954650 TGGCCACAGAGGCTTCCTGCTGG - Intronic
1032793997 7:135263177-135263199 TGGTCACAGAAGTTTCTGGCTGG - Intergenic
1032858467 7:135857113-135857135 TGGCAACAGAAGTTTCTGGCTGG - Intergenic
1034101646 7:148456364-148456386 CAGCCACAGAGGTTTCTGGCTGG - Intergenic
1034210256 7:149357251-149357273 TGGTCATAGAGGTTTCTGGCTGG - Intergenic
1034215728 7:149404409-149404431 TGGCCACAGAAGTTTCCCACTGG - Intergenic
1034251084 7:149691255-149691277 GGGCCACAAAGTTTTCCAGCTGG + Intergenic
1034536053 7:151726538-151726560 TGGACACCGTGGTTTCCAGTCGG - Intronic
1035418229 7:158706839-158706861 TGGCCACGGAGGTTTCTAGCTGG - Intergenic
1035451053 7:158977085-158977107 CAGCCACAGAGGTTTCCGGCCGG + Intergenic
1035579714 8:731955-731977 TGGCCACTCATGTGTCCAGCAGG - Intronic
1036915299 8:12798919-12798941 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1037150398 8:15627958-15627980 TGGCCACAGAGGTTTCCATCTGG + Intronic
1037521806 8:19686948-19686970 TTGGCACAGAGCTTTCCATCAGG + Intronic
1038696340 8:29810090-29810112 GGGCTACAGGAGTTTCCAGCAGG - Intergenic
1039210014 8:35203642-35203664 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
1039228667 8:35419257-35419279 TGGCCGCAGAGATTTCTGGCTGG - Intronic
1040725494 8:50377961-50377983 CAGCCACAGAGGTTTCCATCCGG - Intronic
1041205349 8:55493952-55493974 TAGCCACAGAGATTTCCAGCTGG - Intronic
1041222192 8:55663144-55663166 GGGCCACAGAGGTTTCCAGCTGG - Intergenic
1041274565 8:56143434-56143456 CAGCCACAGAGGTTTCTGGCTGG + Intergenic
1041405730 8:57497333-57497355 GAGCCACAGAGCTTTCCTGCAGG + Intergenic
1041965342 8:63669354-63669376 CGGCCACAGAGGTTTCCAGCTGG - Intergenic
1042336892 8:67639242-67639264 TGGCCACAGAGGTTTCCAGCTGG - Intronic
1042439530 8:68810059-68810081 TGGCCACAGAGGTTTCCAGCTGG - Intronic
1042609159 8:70578154-70578176 CAGCCAAAAAGGTTTCCAGCTGG + Intronic
1042642946 8:70955610-70955632 TGGCCCCACAGGTTTCCAGATGG - Intergenic
1043082392 8:75783627-75783649 CAGCCACAGAGGCTTCCGGCTGG - Intergenic
1043180431 8:77081968-77081990 CAGCCACACAGCTTTCCAGCTGG - Intergenic
1043414354 8:80032826-80032848 AGGCCATGGAAGTTTCCAGCTGG - Intronic
1043702704 8:83311952-83311974 CAACCACAGAGGTTTCCAGTTGG - Intergenic
1043707911 8:83377275-83377297 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
1043734074 8:83723185-83723207 TGTCCACAGAGGTTTCTGACTGG - Intergenic
1043737547 8:83767622-83767644 TGGCCACAGAGGCTTCCAGCTGG - Intergenic
1043750192 8:83925547-83925569 TGGACACAGAGATTGGCAGCTGG - Intergenic
1044149053 8:88751633-88751655 TGGCCACGGAGGTCTCTGGCTGG - Intergenic
1044599033 8:93985422-93985444 TGTCTACAGAGGTCTCCATCTGG - Intergenic
1044614037 8:94120862-94120884 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1044762073 8:95530565-95530587 TGGACACAGTCTTTTCCAGCAGG + Intergenic
1045873458 8:106950969-106950991 TGGCCACAGAAGTTTCTGGCTGG + Intergenic
1045888184 8:107123881-107123903 TGGCCACAAAGTTTTCTGGCTGG + Intergenic
1046186875 8:110733891-110733913 TGGCTACAGAGGTTTCTGGCTGG - Intergenic
1046503601 8:115110608-115110630 CAGCCACAGAGGTTTCCAGCCGG - Intergenic
1046674497 8:117093714-117093736 TGGCCACAGAGGTTTCTGGCTGG - Intronic
1046775530 8:118159548-118159570 CTGCCACAGAGGTTTCCAGCTGG + Intergenic
1047248887 8:123166793-123166815 TGGCCACAGAGGAGAGCAGCAGG - Intergenic
1047318206 8:123754163-123754185 CAGCCACAGAGGTTTCCAGGTGG - Intergenic
1047998272 8:130357410-130357432 TGTGCACATAGGTTTCCACCCGG - Intronic
1048338960 8:133524449-133524471 TGGCCACAGAGGTGTCTGGCTGG - Intronic
1048547738 8:135403436-135403458 TGGCCACAGAAGCTTCCAGCTGG - Intergenic
1048676586 8:136790352-136790374 TGATCACAGAGGTTTTCAACAGG - Intergenic
1049826684 8:144673653-144673675 TGGCCACAGCGGTTTCTGGCTGG - Intergenic
1050182482 9:2935292-2935314 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
1050589502 9:7147855-7147877 CAGCCACAGAGGTTTCCAGCTGG - Intergenic
1050685821 9:8168293-8168315 TGGCTAGAGAAGTTTCCAGGAGG - Intergenic
1050809064 9:9720121-9720143 TGACCCCAGATGTTTCCAGCTGG + Intronic
1050888284 9:10791656-10791678 TGGCCACAGAGGATTCCAACTGG + Intergenic
1050935973 9:11395338-11395360 TTCCCACAGAGGTTTCCACCTGG - Intergenic
1050942139 9:11472628-11472650 CAGCCACAGAGGTTTCCAGCTGG + Intergenic
1051029519 9:12657992-12658014 TGCCCACAGTGGTTTCTAGCTGG - Intergenic
1052158495 9:25226036-25226058 TAGCCACAGAGGTTTCCAGCTGG - Intergenic
1052437320 9:28444966-28444988 TGTCTACAGAGGTTTCTGGCTGG + Intronic
1052466647 9:28838702-28838724 TGGCCACAGAGATTTCCAGCTGG - Intergenic
1052470581 9:28890009-28890031 TGTCCATAAAGGTTCCCAGCTGG + Intergenic
1052580468 9:30348931-30348953 TGGCCACAGAGGATTACAGCTGG - Intergenic
1052597317 9:30576023-30576045 TAACCACAGAGGTTTCTGGCTGG + Intergenic
1052691596 9:31821915-31821937 TGGCCACAGAAGCTTCCAGCTGG + Intergenic
1052798508 9:32946256-32946278 TGGCCAGAGAGGTGCCCAGGAGG - Intergenic
1053602449 9:39624321-39624343 CAGCCACAGAGATTTCCAGCTGG + Intergenic
1053860096 9:42378047-42378069 CAGCCACAGAGATTTCCAGCTGG + Intergenic
1054251087 9:62718114-62718136 CAGCCACAGAGATTTCCAGCTGG - Intergenic
1054565198 9:66752627-66752649 CAGCCACAGAGATTTCCAGCTGG - Intergenic
1054971994 9:71098808-71098830 TGGCCACTGAAATTTCCAGGGGG - Intronic
1055645598 9:78358618-78358640 TGGCCACAGAGGTTACCAGCTGG + Intergenic
1055816680 9:80213964-80213986 AGGCCACAGAGGTTTCTGGCTGG + Intergenic
1056462312 9:86819437-86819459 TGGTCACAGAGGCTTCTGGCTGG + Intergenic
1056994297 9:91442397-91442419 TGACCACAGAGGTTTCTGGCTGG - Intergenic
1057415782 9:94861062-94861084 TGGCCACAGTGGATTCCAGGTGG - Intronic
1057510677 9:95677581-95677603 TGGCCACAGAGATTTCCAGCTGG - Intergenic
1058077843 9:100668410-100668432 CAGCCACAAAGGTTTCCAGCTGG + Intergenic
1058270494 9:102967013-102967035 TGGCCAAAGGAGTTTCCGGCTGG - Intergenic
1058487529 9:105457607-105457629 CAGCTACAGAGGTTTCTAGCTGG - Intronic
1058545612 9:106058455-106058477 TGGCCACAGACGTGTCCAGCTGG - Intergenic
1058774931 9:108273635-108273657 TGGCCACACAGTTTTCCACAGGG + Intergenic
1058884384 9:109312475-109312497 TTGCCCCAGAGGTTCCGAGCTGG - Intronic
1060229292 9:121814912-121814934 GGGCCACAGGGGTTACCCGCGGG + Intergenic
1060618954 9:125045150-125045172 TAGCCACAGAGGTTTCTGGCTGG + Intronic
1060765665 9:126293668-126293690 TGGCCACAGAGGGTTCCTCAGGG - Intergenic
1060943610 9:127557393-127557415 AGGCCACAGAGGTCTGAAGCAGG + Intronic
1062329286 9:136029972-136029994 CGGCCACAGAGGTTTCTGGCGGG + Intronic
1062572671 9:137192833-137192855 GGGGCACAGAGCTCTCCAGCTGG + Intronic
1185936119 X:4258353-4258375 TGGCCACAGAGGTTTCCGGCTGG + Intergenic
1186223486 X:7374313-7374335 TGGCCAGAGAGGTTTCTGGCTGG - Intergenic
1187087450 X:16056005-16056027 TGGCCACAGAAGTTTATTGCAGG + Intergenic
1187871059 X:23765931-23765953 TGGTCACAGAGCTTTCTAGCTGG - Intronic
1188195092 X:27223032-27223054 TGGCCACAGAGGCTTCCAGCTGG + Intergenic
1188207938 X:27381781-27381803 TGGCCACAGAGGTTTCCGGCTGG + Intergenic
1188435174 X:30150644-30150666 TAGCCACAGAAGTTTCTAGCTGG + Intergenic
1188648027 X:32593164-32593186 CGGCCACAGAGGTTTCTGGCTGG + Intronic
1188727598 X:33606031-33606053 TGGCCACAGAGGTTTCTGGGTGG - Intergenic
1188756679 X:33970429-33970451 TGGCCACAGAGGTTTCTGGCTGG + Intergenic
1189024035 X:37371948-37371970 TGGCCACAGAGGTTTCTGGCTGG + Intronic
1189225078 X:39406310-39406332 TGGAGAAAGATGTTTCCAGCAGG - Intergenic
1190621338 X:52289266-52289288 TGGCCACAGAGGTTTCCATCTGG + Intergenic
1191016524 X:55814710-55814732 TGGTCACAGAGGTTTCTGGCTGG + Intergenic
1191815095 X:65235474-65235496 TGGCTGGAGAGATTTCCAGCTGG - Intergenic
1192227465 X:69238938-69238960 TGCCCACAGGGGTTTCCAGATGG - Intergenic
1192325395 X:70127963-70127985 CAGCCACAGAGGTCTCCAGTGGG - Intergenic
1193211314 X:78810335-78810357 TGGCCACAGAAGTTTCCAGCTGG - Intergenic
1193554317 X:82933659-82933681 TGGCCACAGATGTTTCCAGCTGG + Intergenic
1194212351 X:91083550-91083572 TAGCCACAGAGGTTTCCAGCTGG + Intergenic
1194316281 X:92380441-92380463 CGGCCACAGAGGTTTCTGTCTGG + Intronic
1194684058 X:96890099-96890121 TGGCCACAGAGGTTTCTAGCTGG + Intronic
1195880155 X:109585501-109585523 TGGCCACAGAGGTTTCCAGCTGG - Intergenic
1196633639 X:117973890-117973912 TGGCCAAGCAGGTGTCCAGCAGG + Intronic
1196737197 X:118990277-118990299 GGCTCTCAGAGGTTTCCAGCAGG - Intronic
1197035839 X:121871476-121871498 TGGCCATAGAGGTTGCTGGCTGG + Intergenic
1197342368 X:125288680-125288702 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1197378552 X:125710843-125710865 TGGCCACAGAAGCTTCCAGCTGG + Intergenic
1197609395 X:128622288-128622310 TGGCCACAGAGGTTTGCAGCTGG - Intergenic
1198047087 X:132913672-132913694 TGGCTGCAGAGGTCTCCAGCTGG + Intronic
1199187844 X:144938440-144938462 TGGCCACAGAGGTTTCTGGCTGG - Intergenic
1199498179 X:148477598-148477620 TGGCCACAGAGCCTTACAGTAGG - Intergenic
1200973624 Y:9182642-9182664 TGGCCACAGGGGTTTCCATCTGG + Intergenic
1201720442 Y:17090415-17090437 TGGCCACAGAGGTTTCCAGCTGG + Intergenic
1201780511 Y:17716385-17716407 TGGTCACAGAGGTTTTCATCTGG - Intergenic
1201797033 Y:17906850-17906872 TGGCCACAGAGGTTTTCAATTGG + Intergenic
1201798069 Y:17923576-17923598 TGGCCACAGGGGTTTTCATCTGG - Intergenic
1201803484 Y:17982381-17982403 TGGCCACAGGGGTTTTCATCTGG + Intergenic
1201804520 Y:17999135-17999157 TGGCCACAGAGGTTTTCAATTGG - Intergenic
1201821043 Y:18189605-18189627 TGGTCACAGAGGTTTTCATCTGG + Intergenic
1202135774 Y:21659386-21659408 TGGCCATAAAGGTTTTCATCTGG + Intergenic
1202137456 Y:21681874-21681896 TGGCCACAGTGGTTTCCATCCGG - Intergenic
1202358405 Y:24075909-24075931 TGGCCGCAGAGGTTTTCAACTGG + Intergenic
1202359394 Y:24092267-24092289 TGGCCACAGGGGTTTTCATCTGG - Intergenic
1202511384 Y:25577847-25577869 TGGCCACAGGGGTTTTCATCTGG + Intergenic
1202512373 Y:25594204-25594226 TGGCCGCAGAGGTTTTCAACTGG - Intergenic