ID: 933459192

View in Genome Browser
Species Human (GRCh38)
Location 2:82558542-82558564
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933459192 Original CRISPR ACTATGTTAGGTCTACAAGT GGG (reversed) Intergenic