ID: 933459727

View in Genome Browser
Species Human (GRCh38)
Location 2:82566863-82566885
Sequence CTTGGTTACAGATAGCTGCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933459725_933459727 -1 Left 933459725 2:82566841-82566863 CCTTTGACTAGAGTTTATACTAC No data
Right 933459727 2:82566863-82566885 CTTGGTTACAGATAGCTGCAAGG No data
933459724_933459727 10 Left 933459724 2:82566830-82566852 CCATTTAGATTCCTTTGACTAGA No data
Right 933459727 2:82566863-82566885 CTTGGTTACAGATAGCTGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933459727 Original CRISPR CTTGGTTACAGATAGCTGCA AGG Intergenic
No off target data available for this crispr