ID: 933460529

View in Genome Browser
Species Human (GRCh38)
Location 2:82577982-82578004
Sequence GGCGCCCGCCGCCACCATGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933460529_933460539 29 Left 933460529 2:82577982-82578004 CCTGCATGGTGGCGGCGGGCGCC No data
Right 933460539 2:82578034-82578056 CAGGAGAATCGTTTGAACCCGGG 0: 1729
1: 47421
2: 150612
3: 221325
4: 164942
933460529_933460531 -3 Left 933460529 2:82577982-82578004 CCTGCATGGTGGCGGCGGGCGCC No data
Right 933460531 2:82578002-82578024 GCCTGTAACCCGAAGTACTCGGG No data
933460529_933460536 6 Left 933460529 2:82577982-82578004 CCTGCATGGTGGCGGCGGGCGCC No data
Right 933460536 2:82578011-82578033 CCGAAGTACTCGGGAGGCTGAGG No data
933460529_933460538 28 Left 933460529 2:82577982-82578004 CCTGCATGGTGGCGGCGGGCGCC No data
Right 933460538 2:82578033-82578055 GCAGGAGAATCGTTTGAACCCGG 0: 1692
1: 46644
2: 124402
3: 149770
4: 75827
933460529_933460530 -4 Left 933460529 2:82577982-82578004 CCTGCATGGTGGCGGCGGGCGCC No data
Right 933460530 2:82578001-82578023 CGCCTGTAACCCGAAGTACTCGG No data
933460529_933460537 10 Left 933460529 2:82577982-82578004 CCTGCATGGTGGCGGCGGGCGCC No data
Right 933460537 2:82578015-82578037 AGTACTCGGGAGGCTGAGGCAGG 0: 97
1: 3516
2: 103022
3: 255657
4: 204024
933460529_933460533 0 Left 933460529 2:82577982-82578004 CCTGCATGGTGGCGGCGGGCGCC No data
Right 933460533 2:82578005-82578027 TGTAACCCGAAGTACTCGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933460529 Original CRISPR GGCGCCCGCCGCCACCATGC AGG (reversed) Intergenic
No off target data available for this crispr