ID: 933467214

View in Genome Browser
Species Human (GRCh38)
Location 2:82668221-82668243
Sequence TGATGGAATAAGGATCAACT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933467214_933467217 -1 Left 933467214 2:82668221-82668243 CCAAGTTGATCCTTATTCCATCA No data
Right 933467217 2:82668243-82668265 AACAAATTATTTTAATATATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933467214 Original CRISPR TGATGGAATAAGGATCAACT TGG (reversed) Intergenic
No off target data available for this crispr