ID: 933469414

View in Genome Browser
Species Human (GRCh38)
Location 2:82702261-82702283
Sequence CAGGATACACAGTTCCAAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933469409_933469414 8 Left 933469409 2:82702230-82702252 CCTGGAAATAAAACTGCATGAGG No data
Right 933469414 2:82702261-82702283 CAGGATACACAGTTCCAAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933469414 Original CRISPR CAGGATACACAGTTCCAAAA GGG Intergenic
No off target data available for this crispr