ID: 933478048

View in Genome Browser
Species Human (GRCh38)
Location 2:82817789-82817811
Sequence GGTTAAGTATTGACATCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 1, 2: 4, 3: 6, 4: 95}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933478048_933478049 -10 Left 933478048 2:82817789-82817811 CCTTCAGATGTCAATACTTAACC 0: 1
1: 1
2: 4
3: 6
4: 95
Right 933478049 2:82817802-82817824 ATACTTAACCCTCATGTTTCAGG 0: 1
1: 3
2: 6
3: 16
4: 129

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933478048 Original CRISPR GGTTAAGTATTGACATCTGA AGG (reversed) Intergenic
904574077 1:31491445-31491467 GTTTAAGTACTGAAATGTGAGGG - Intergenic
907898598 1:58717047-58717069 TGTTAATTATTTACATATGAGGG + Intergenic
911789437 1:101993888-101993910 GCTTAAGTATCGCCATCTTATGG - Intronic
913591649 1:120334461-120334483 GGCTAAATATTGACATGGGATGG + Intergenic
913651711 1:120920688-120920710 GGCTAAATATTGACATGGGATGG - Intergenic
914169394 1:145208377-145208399 GGCTAAATATTGACATGGGATGG + Intergenic
914524511 1:148452341-148452363 GGCTAAATATTGACATGGGATGG + Intergenic
914599157 1:149183489-149183511 GGCTAAATATTGACATGGGATGG - Intergenic
914641892 1:149614799-149614821 GGCTAAATATTGACATGGGATGG - Intergenic
922615369 1:226958140-226958162 GATCAAATATTGACATCTGAGGG - Intronic
923615973 1:235537767-235537789 GGTCAAATATTGACATCTGAGGG + Intergenic
923866920 1:237949458-237949480 GATCAAGTATTGACATTTCAGGG + Intergenic
924682628 1:246252970-246252992 GGTTGAGTATTGCCATCACATGG - Intronic
1068685840 10:59869245-59869267 GGTTAAGTCTGGAGATCTGAGGG - Intronic
1069651216 10:70051235-70051257 GGTGAAGAATGGACACCTGAAGG + Intergenic
1074329949 10:112496262-112496284 GTTGAAGTATTTACATATGAAGG + Intronic
1077382174 11:2249269-2249291 TGTTAAGTGTTGACAACTAATGG + Intergenic
1078655826 11:13238236-13238258 GGTTAAGTATGGAAATGTCAGGG + Intergenic
1079732445 11:23951877-23951899 GTTTAAGTATTGGCAAATGAAGG - Intergenic
1085398278 11:76218799-76218821 GGTTAAGTGTTGTCTGCTGATGG - Intergenic
1086533684 11:87816462-87816484 GATCAAGTGTTGACATTTGAGGG + Intergenic
1087609817 11:100420855-100420877 GGTTAAATAGTTTCATCTGAGGG - Intergenic
1087955340 11:104279294-104279316 GAATGAGTATTGAGATCTGATGG + Intergenic
1088006264 11:104944726-104944748 GGTTAAGTATTGAGAGTTGTTGG - Exonic
1096841928 12:54385101-54385123 TATTAACTATTGACATCTGTGGG + Intronic
1098881176 12:75919106-75919128 CCTTAAGTATGGACATCAGAGGG - Intergenic
1108666291 13:52634853-52634875 GGGTTAGTATGTACATCTGAAGG + Intergenic
1109540543 13:63773338-63773360 GATGATGTATTGCCATCTGAAGG - Intergenic
1119492634 14:75050265-75050287 GGTTAAGTATAGTCACCTCAGGG + Intronic
1120412593 14:84176080-84176102 GGTCAAGTATTGACATCTGAGGG - Intergenic
1124566716 15:30822552-30822574 GCAGAAGAATTGACATCTGAAGG - Intergenic
1127351230 15:58154645-58154667 GGTCAAGTATTGACATTTGAGGG - Intronic
1132209577 15:100010044-100010066 GAATAAGTCTTGAGATCTGATGG + Intronic
1136421956 16:30140209-30140231 GATAAAGGATTGACATCTCAAGG - Intergenic
1140417723 16:74788129-74788151 CGTTAAGGATCTACATCTGATGG - Intergenic
1141226594 16:82122095-82122117 AGTCAAATATTGACATTTGAGGG + Intergenic
1143161716 17:4876203-4876225 GAGGAAGTATTGACAGCTGAAGG - Intronic
1150798619 17:68260915-68260937 GGTTAAGTATGGAGGTCTGTGGG - Intronic
1153089169 18:1324215-1324237 GGTTAAGTAGGCACATATGAGGG - Intergenic
1157075440 18:44461394-44461416 GCTGAATTATTCACATCTGAAGG - Intergenic
1164424441 19:28128479-28128501 GGGTAACCATTGACATCTTAAGG - Intergenic
1164753666 19:30673977-30673999 GGGGAATTATTGACAGCTGATGG - Intronic
1165239055 19:34448834-34448856 GGTTCAGTACAGAAATCTGAGGG + Intronic
926939073 2:18115973-18115995 GAATAAGTCTTGAGATCTGATGG + Intronic
928446636 2:31339039-31339061 GGTCGAGTATTGGCAACTGAAGG + Intronic
928959917 2:36913473-36913495 TGTTTAATTTTGACATCTGAAGG - Intronic
931346376 2:61450808-61450830 GGGTAAGAGTTGACATCTTACGG - Intronic
932026972 2:68143618-68143640 GGTTAAGTACGGCCATATGATGG + Intronic
933478048 2:82817789-82817811 GGTTAAGTATTGACATCTGAAGG - Intergenic
939280195 2:140054090-140054112 AGTTCAGTTTTGAAATCTGAGGG + Intergenic
939510098 2:143094477-143094499 GGTCAACTATTGACATTTGAGGG + Intronic
940562284 2:155313689-155313711 GGTCAAGTATTGACATTTGAGGG - Intergenic
946803710 2:223449065-223449087 CTTTAATTATTGGCATCTGAAGG - Intergenic
1169792174 20:9422889-9422911 GGTTGCCTATTTACATCTGAAGG - Intronic
950304949 3:11910323-11910345 GATTCAGTGTTGACACCTGAGGG - Intergenic
950414075 3:12858409-12858431 GATTCAGTATTGACACCTGGTGG - Intronic
950414345 3:12860144-12860166 GATTCAGTATTGACACCTGGTGG - Intronic
950414954 3:12863869-12863891 GATTCAGTATTGACACCTGGGGG - Intronic
950416698 3:12873009-12873031 GATTCAGTATTGACACCTGGGGG - Intergenic
957301394 3:78396507-78396529 GGTGAAGTATTTATATTTGATGG - Intergenic
957628690 3:82689261-82689283 GGTTTATTATTCACATTTGATGG + Intergenic
959799304 3:110472579-110472601 GTTTAAGAATTTACTTCTGAAGG + Intergenic
961713618 3:128844881-128844903 GATTCAGTATTGACACCTGGAGG + Intergenic
963686595 3:148442785-148442807 GGATAAGTATTTAGATCTGTGGG - Intergenic
965318882 3:167226783-167226805 GGTTAAGTAAAGACACATGATGG - Intergenic
965661794 3:171049824-171049846 GGTTCAGTAAGGACATTTGAAGG + Intergenic
966132999 3:176665816-176665838 GCTTAAGGACTGATATCTGAGGG - Intergenic
970101046 4:12523391-12523413 GTGTAAGTATTGAAATCTAAAGG + Intergenic
981480329 4:145232235-145232257 GTGAAAGTATTGACATCTGTTGG - Intergenic
982814752 4:159870836-159870858 GGTTAAGTATGGACTACAGAAGG + Intergenic
987657288 5:20822913-20822935 GTTTAAGTATGGACATATGGAGG - Intergenic
988409884 5:30873834-30873856 GGTAAAATATTGGCAACTGAGGG + Intergenic
988766258 5:34381035-34381057 GTTTAAGTATGGACATATGGAGG + Intergenic
990081683 5:51924035-51924057 ACTTAAGCATTCACATCTGATGG + Intergenic
993262303 5:85674286-85674308 GAATAAGTCTTGAGATCTGATGG - Intergenic
993889688 5:93458280-93458302 GTTTAAGTACTGAAATCAGATGG - Intergenic
998773549 5:145573066-145573088 GGTTAAGTAGAGACCTCAGAAGG - Intronic
1005227720 6:23661839-23661861 GGTTTAGAATTCACTTCTGAAGG + Intergenic
1005329858 6:24739387-24739409 GGTTAAGTACTGAGCTCTGAGGG + Intergenic
1008323081 6:50142093-50142115 GGTTAATAATTGAGGTCTGAAGG - Intergenic
1012919428 6:105206083-105206105 GTTTTAGTAGTGAGATCTGAGGG - Intergenic
1014642086 6:123924832-123924854 GTTTCATTCTTGACATCTGAAGG - Intronic
1017285439 6:152670083-152670105 GGTTATGTATTGCCATCTTCTGG + Intergenic
1017305495 6:152913844-152913866 GTTTAAGTATTGACCTCTCTAGG + Intergenic
1029349124 7:100000580-100000602 GGTTAAGTCTTTACTTCTGTTGG - Intergenic
1030760355 7:113342472-113342494 GAATAACTATTGACATCTGTGGG - Intergenic
1033139074 7:138809016-138809038 GGTCAAGTCTTTACATGTGAGGG - Intronic
1037560664 8:20071876-20071898 GGTTATGTATTGACCACTGGAGG + Intergenic
1040377328 8:46839025-46839047 GGTAAAGTATTGACATTTGAGGG + Intergenic
1041454875 8:58047986-58048008 GCTTAATGATTTACATCTGAAGG + Intronic
1044619763 8:94177329-94177351 GGATAAGTAATGCCATCAGAGGG + Intronic
1045642755 8:104270114-104270136 GAATAAGTCATGACATCTGATGG - Intergenic
1047198643 8:122744706-122744728 GGTTAAGTATTCAAATTTTATGG - Intergenic
1048522980 8:135174091-135174113 GGTTAAGGATTTACATATCAAGG + Intergenic
1051871963 9:21748316-21748338 GGCAAACTATTTACATCTGATGG + Intergenic
1052576459 9:30298540-30298562 GGCAAAGTATTAACACCTGATGG - Intergenic
1058336989 9:103842241-103842263 GGGTAAACATAGACATCTGAGGG - Intergenic
1059987502 9:119834940-119834962 GCTTGAGTTTTGAGATCTGAAGG - Intergenic
1060153124 9:121301177-121301199 GATTTACTATTGCCATCTGAGGG + Intronic
1187115823 X:16349402-16349424 TATTAAGTCTTGATATCTGATGG - Intergenic
1187631465 X:21177472-21177494 TGTTAACAATTGACATGTGATGG - Intergenic
1189866229 X:45330490-45330512 GGTTAACTATTGATATGTTAGGG - Intergenic
1192816632 X:74600626-74600648 GGTTAAGTTCTGACATTTGAAGG + Intronic
1193923072 X:87453560-87453582 GGTTTAGTCTTGATATCTGAAGG + Intergenic
1196283097 X:113846949-113846971 GGTTAAGAATAGGCTTCTGATGG - Intergenic
1196494588 X:116309485-116309507 GGTTAACTATTGAAATCTATTGG + Intergenic
1197545979 X:127824588-127824610 GGGATAGTATTGACATCTTACGG - Intergenic