ID: 933480484

View in Genome Browser
Species Human (GRCh38)
Location 2:82851186-82851208
Sequence AAACCCTGCTTCACAAAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933480482_933480484 19 Left 933480482 2:82851144-82851166 CCAGTTTACTTCATAATCTCTTT No data
Right 933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933480484 Original CRISPR AAACCCTGCTTCACAAAGAC AGG Intergenic