ID: 933480484

View in Genome Browser
Species Human (GRCh38)
Location 2:82851186-82851208
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 291
Summary {0: 7, 1: 30, 2: 30, 3: 30, 4: 194}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933480482_933480484 19 Left 933480482 2:82851144-82851166 CCAGTTTACTTCATAATCTCTTT No data
Right 933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG 0: 7
1: 30
2: 30
3: 30
4: 194

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902492079 1:16790170-16790192 AGACCCTGCTTCCCAGAGGCAGG - Intronic
903276607 1:22225992-22226014 AATCCCTGAATCACAAAGCCAGG - Intergenic
905008872 1:34733270-34733292 TAACCCTGCTTCACAGACAAAGG - Intronic
905664429 1:39754128-39754150 AAAACCTGATTCATAAAAACAGG - Intronic
907827394 1:58032055-58032077 AAACTCTGCTTCTCAAAGTGTGG + Intronic
908438473 1:64130353-64130375 AAACTCTGCTTTCTAAAGACCGG - Intronic
908806882 1:67940869-67940891 CATCTCTGCTTCACAATGACTGG + Intergenic
909122292 1:71618456-71618478 AAACCCTGCTTCACAAAGACAGG - Intronic
909662269 1:78097317-78097339 AAACTCTGCCTCACTAAGACTGG - Intronic
910646832 1:89524178-89524200 AAACCCTCCCTCACAGAGGCTGG + Intergenic
911729576 1:101278935-101278957 AGAGCATGCTTCACAGAGACAGG + Intergenic
911792356 1:102033614-102033636 AAACCCTGCTTCACAAAGATAGG - Intergenic
915609231 1:156977831-156977853 AAACCCTGGTTAACACTGACTGG + Intronic
916583272 1:166127372-166127394 AAACCCTTCTGCTCAAAGTCTGG - Intronic
916639900 1:166716598-166716620 AGACCCTGCCTCAAAAAGAAAGG + Intergenic
917215227 1:172671294-172671316 GAACCCTCCTCCACAAAGAATGG - Intergenic
917516794 1:175715023-175715045 AAACCATGCTTCTCAAAGTGTGG + Intronic
918017006 1:180644998-180645020 AAAACCTGCTTCACAAAGATAGG + Intronic
918217649 1:182406992-182407014 AAACCCAGCTTTAGGAAGACAGG + Intergenic
918750947 1:188268590-188268612 AAACCCTGCTTCACAAAAATAGG + Intergenic
918946168 1:191068277-191068299 AAATCCTGTTTTACAAAGTCAGG - Intergenic
919091322 1:192981557-192981579 AAACCCTGCTTCACAAAGATAGG - Intergenic
919838369 1:201592090-201592112 AAGCCCTGCTTCAGGAAGAGAGG - Intergenic
920924872 1:210331342-210331364 AGACCCTGCTTCACAAAGATAGG + Intronic
922671797 1:227514180-227514202 AAACCCTGCTTCACAAAGACAGG + Intergenic
923528367 1:234792367-234792389 AGACCCTGCTTCCCAGAGGCAGG + Intergenic
924244505 1:242070668-242070690 AAACCCTGTTTCACAAAGACAGG + Intergenic
924788757 1:247223643-247223665 AAACCATGCTTCATAAATAAAGG + Intergenic
924821773 1:247498992-247499014 AAACCATGCTTCACAAAGACAGG + Intergenic
1063005885 10:1970249-1970271 AAATCCTGCTTCACAAAGACAGG - Intergenic
1063594393 10:7420640-7420662 AAACCCTGCTTCCCAAAGATAGG - Intergenic
1065193596 10:23238571-23238593 GAAGCCTGTTTCACAAAGCCTGG + Intronic
1066608259 10:37205661-37205683 AAACACAGCTTCACATAGTCAGG - Intronic
1067728261 10:48790009-48790031 AAACCCTGCTTCCCAAATAGCGG - Intronic
1068163331 10:53296745-53296767 AGACCCTGCTTCACAAAGATAGG + Intergenic
1068941308 10:62683890-62683912 AAAACTTGATTCACAAAAACAGG + Intergenic
1069998099 10:72355335-72355357 AAACCATGCCTCACAAACAGTGG - Intergenic
1070615233 10:77964555-77964577 AAACCCTGCTTCACAAGGATAGG - Intergenic
1071625276 10:87162395-87162417 AAACCCTGAGTGACAAAGGCTGG + Intronic
1072224505 10:93355984-93356006 AAACCCTGCTACTGAAAGAAAGG + Intronic
1073867536 10:107822158-107822180 AAACCCTGCTTCCTAAAATCAGG - Intergenic
1074628204 10:115218278-115218300 AAACTCTGCTCCACGAAGACAGG + Intronic
1075446203 10:122515094-122515116 AAGTCCTGCTTCATAAAGCCAGG - Intergenic
1078826109 11:14931718-14931740 AAATCCTGCTTCACAAAGATAGG + Intronic
1079000617 11:16752005-16752027 AAACCCTGTTTCACAAAGACAGG - Intronic
1079570121 11:21932646-21932668 AAACCCTGCTTCACAAAGATAGG - Intergenic
1079984044 11:27181342-27181364 AAAACATGATTTACAAAGACAGG + Intergenic
1081001754 11:37682418-37682440 ATATCCTGCTTCACTAAGATAGG - Intergenic
1082990722 11:59205261-59205283 AACCCCGGCTTCCCAAAGCCAGG - Exonic
1083039403 11:59670965-59670987 AAAGCTTGCTTTACAAAAACGGG - Intergenic
1083083813 11:60121921-60121943 AAACCCTGCTTCATAAAGATAGG - Intergenic
1084555422 11:69872823-69872845 CAAACCTGATACACAAAGACTGG - Intergenic
1088057177 11:105598501-105598523 AGGCCCTACTTCAGAAAGACAGG + Intergenic
1090709372 11:129372322-129372344 AAAACCTACTTCACAAGGATGGG - Intergenic
1091363209 11:134994619-134994641 AAACCCTTTTTCACAAAGGAGGG + Intergenic
1092407430 12:8230714-8230736 GATCCCTGCTTCACACAGCCAGG + Intergenic
1092729272 12:11513005-11513027 ACACCCTTCTTCACTGAGACTGG - Intergenic
1094812782 12:34156141-34156163 AAAGCCTGCTTCACAAAGACAGG - Intergenic
1096343057 12:50819096-50819118 AAACCTTTCTACAAAAAGACTGG + Intronic
1100158125 12:91825667-91825689 AAATCCCCTTTCACAAAGACAGG - Intergenic
1100383894 12:94087776-94087798 AGAGCCTGCTTCCCAAAGAAAGG - Intergenic
1100759840 12:97795146-97795168 ATAAGTTGCTTCACAAAGACTGG - Intergenic
1101486194 12:105163509-105163531 AGACCCTGCCTCAAAAAGAAAGG - Intronic
1105646265 13:22321166-22321188 AAGCCCTGCTTTACACAGCCTGG - Intergenic
1106623352 13:31393034-31393056 ACACTTTGCTTCACAAAGATAGG + Intergenic
1109413545 13:62006473-62006495 AAACCCAACTTCATGAAGACAGG + Intergenic
1110482239 13:75992915-75992937 AAACCCTGCATCAAAGACACAGG + Intergenic
1112865565 13:103892365-103892387 AAACCCAGTTTCACAAAGACAGG - Intergenic
1113292593 13:108923073-108923095 AAACCCTGATTCGTAAAAACAGG + Intronic
1113349718 13:109517146-109517168 AAAACCTCCTACACAAAGGCAGG - Intergenic
1113401436 13:109997657-109997679 AAACCCTGCTTCAGAAAGATAGG - Intergenic
1114284222 14:21225009-21225031 GAAACCTGGTTCAAAAAGACTGG - Intronic
1116140382 14:40985936-40985958 AAACCCTGCTTCACAAAAATGGG + Intergenic
1116539568 14:46082845-46082867 AATCACTGCTTTACAAATACAGG + Intergenic
1117668164 14:58078763-58078785 AAACCTTTCTTTACAAAAACAGG + Intronic
1118526620 14:66651729-66651751 AAACCCTGCTTCACAAAGACAGG - Intronic
1120149826 14:81020889-81020911 AAACCCTGCTTCACAAAGATAGG - Intronic
1121034325 14:90687638-90687660 CAAACCTGCTTCACAATGAGGGG + Intronic
1122098050 14:99386040-99386062 ACACCCTGCTTCATGAAGACGGG + Intergenic
1122855927 14:104560030-104560052 GACCCCGGCTTCACACAGACAGG + Intronic
1123181015 14:106470206-106470228 AAACCTTGCTGCAGGAAGACAGG - Intergenic
1124440275 15:29680753-29680775 AAACTCTGCTTCACAAACACAGG + Intergenic
1124847142 15:33302131-33302153 AAACACTTCAACACAAAGACAGG - Intergenic
1125444428 15:39737941-39737963 AAACCCTGTTTTACTAACACAGG - Intronic
1126457249 15:48877140-48877162 AAATCCTGCCTCACAAAGATAGG - Intronic
1126928415 15:53618581-53618603 AATCCCTTCTTCACGAATACTGG - Intronic
1127178445 15:56387075-56387097 AAACCATGCTTCAAGCAGACTGG - Intronic
1127880346 15:63151816-63151838 AAACCCAGCTTCACAAGGATAGG - Exonic
1131631752 15:94184559-94184581 AAACCCTGCTTCACAAAGACAGG + Intergenic
1133627911 16:7589476-7589498 AAAGGCAGCTTCACAAAGTCAGG - Intronic
1134844578 16:17429069-17429091 AAATGCTGCTTTTCAAAGACGGG - Intronic
1135802377 16:25509951-25509973 ACTCCATGCTTCAAAAAGACAGG + Intergenic
1138425540 16:56929768-56929790 AAACCCTGCTTCACAGAGATGGG + Intergenic
1140581985 16:76241360-76241382 AAATCCTCCTTCACAAAGATAGG - Intergenic
1140601045 16:76475264-76475286 AAACTCTGCTCCCCAAAGATAGG + Intronic
1141108628 16:81253947-81253969 AGACCCTGTCTCACAAAGAAAGG + Intronic
1144471202 17:15542981-15543003 AAACACTGCTAGAAAAAGACTGG + Intronic
1144925264 17:18801712-18801734 AAACACTGCTAGAAAAAGACTGG - Intronic
1146474852 17:33154495-33154517 AATACCTGCTTCACCAAGATTGG - Intronic
1149440340 17:56668629-56668651 AAACCCTGCTTTACAAAGATAGG - Intergenic
1149679210 17:58493285-58493307 AAAACCTGATTTACAAAAACAGG - Intronic
1150797408 17:68249088-68249110 AAAGCCAGCCTCACAATGACAGG - Intronic
1151283091 17:73091046-73091068 AGACCCTGATTCAGAAAGTCTGG - Intronic
1152163770 17:78687304-78687326 AAACACTGCTTCACAAAGACAGG + Intronic
1153784819 18:8525306-8525328 AAACCCTGCTTCCCAAAACAGGG + Intergenic
1155112243 18:22727506-22727528 AAATTCTGCTTCACTAAGATAGG - Intergenic
1155561913 18:27087997-27088019 AAACGCTCCTTTTCAAAGACTGG + Intronic
1157558443 18:48628994-48629016 AGACCCAACTTCTCAAAGACAGG - Intronic
1159792535 18:72800381-72800403 AAACCCTGCTTCACAAAGATAGG - Intronic
1160426208 18:78780983-78781005 AAACCCAGCCTCACAAAATCTGG + Intergenic
1161164915 19:2781494-2781516 AAACCTTCATTCACAAAAACAGG + Intronic
1161304977 19:3562283-3562305 AAACTGAGTTTCACAAAGACGGG + Intronic
1165780091 19:38427453-38427475 ACACCCTGCTTAAGAAAGGCAGG - Intergenic
1166259389 19:41627224-41627246 CAACCCTGCTTCTCAAAGTGTGG - Intronic
1168373841 19:55859080-55859102 ACTGCCTGCTTCACAAAGGCAGG - Exonic
1168717802 19:58539375-58539397 ACACCCTGCTTCCCTCAGACAGG + Intergenic
1168718131 19:58540767-58540789 AGACCCTGCTTCCCTCAGACAGG + Intergenic
1168718424 19:58541966-58541988 AGACCCTGCTTCCCTCAGACAGG + Intergenic
1168718566 19:58542549-58542571 AGACCCTGCTTCCCTCAGACAGG + Intergenic
926288033 2:11506249-11506271 AAACCACGCTTCTCAAGGACAGG - Intergenic
926620525 2:15043003-15043025 AAAACTTGCTTTACAAAAACAGG + Intergenic
926824699 2:16892887-16892909 AAACTCTGCTTCACAAACATAGG - Intergenic
927844828 2:26465940-26465962 AAGCCTTACTTCCCAAAGACAGG + Exonic
928040359 2:27869835-27869857 AAACTCTGCTTCACAAAGATAGG + Intronic
928228130 2:29472279-29472301 TGCCCCTGCTTCACAATGACTGG - Intronic
929174662 2:38964156-38964178 AAACCCTGCTTCACAAAGATGGG + Intronic
929226751 2:39519015-39519037 AAACTCAGCTTCCCAAAGACAGG - Intergenic
929355046 2:41013618-41013640 AAACCCTGTTTGACAAAATCGGG - Intergenic
929676200 2:43932872-43932894 ACACCTTACTACACAAAGACAGG + Intronic
930403121 2:50916789-50916811 AAACTTTGCTTCACAGAGCCAGG + Intronic
932972930 2:76567669-76567691 AAACCATCCTTAACAAAGGCAGG - Intergenic
933480484 2:82851186-82851208 AAACCCTGCTTCACAAAGACAGG + Intergenic
934559776 2:95307082-95307104 ACCCCCTGCCTCACAAAGAGGGG + Intronic
935018796 2:99211092-99211114 AAAGCCTTCTTAACAAGGACAGG - Intronic
935057527 2:99580596-99580618 AAAACCTGCTTCGCAGAGGCCGG + Intronic
935511807 2:103985054-103985076 AAACCTTTATTCACAAAAACAGG - Intergenic
936689924 2:114874410-114874432 AAACCCTGCTTCACCAAGATAGG - Intronic
937018048 2:118624286-118624308 AAACCCTATTTCACAAAGATAGG - Intergenic
937165890 2:119816753-119816775 AAACACTGCTTCATAAAGATAGG + Intronic
937836775 2:126479191-126479213 AAACCCCACTTCATAAAGATAGG - Intergenic
938712533 2:133988049-133988071 AATCCCTGCCTCATAAAGAATGG - Intergenic
939012719 2:136865226-136865248 AAACCATGCTTCATAGAGAATGG + Intronic
939306519 2:140418567-140418589 AAATCCTGCTTCACAAATATGGG - Intronic
940564170 2:155339475-155339497 AAACCCTGCTTCTCAGAGGGAGG + Intergenic
943745680 2:191460646-191460668 AGACCCTGCCTGACAAAGAGGGG - Intergenic
943818692 2:192290459-192290481 AAACCCTGCTTCACAAAGATAGG + Intergenic
944450452 2:199836752-199836774 AAACCCTGTTTCAAAAAAAAAGG + Intronic
945408212 2:209476944-209476966 AAAACCTTCATCACAAAGATTGG + Intronic
947034820 2:225840195-225840217 GAAACCTTCTTAACAAAGACTGG + Intergenic
947095112 2:226557852-226557874 AAACCCAGCATCCAAAAGACAGG + Intergenic
1169225235 20:3852288-3852310 AAAGCCTGCTACACATAGGCCGG - Intronic
1169959625 20:11144724-11144746 CAAACCTGCTCCACGAAGACAGG - Intergenic
1170744220 20:19084355-19084377 AAATCCTGATTCCCAAAGATAGG - Intergenic
1170771409 20:19336209-19336231 AAACCTTTATTCACAAAAACGGG - Intronic
1170993153 20:21323813-21323835 AAAACCTGACTCACAAAAACAGG - Intronic
1172305681 20:33878620-33878642 ATTCCATGATTCACAAAGACAGG + Intergenic
1174417921 20:50379717-50379739 GAACCCTGCATCGCAAGGACAGG - Intergenic
1175694980 20:61095740-61095762 GAAAACTGCTTCACAAAGATAGG + Intergenic
1175951945 20:62588247-62588269 GAACCCTGATTCACAAACCCCGG - Intergenic
1176193735 20:63826918-63826940 AAACCCTGCTTCCCGGAGAGTGG - Intronic
1177273880 21:18881698-18881720 AAACCATGATTCACATAGATAGG + Intergenic
1177319509 21:19501892-19501914 AAACACAACTTCACAGAGACAGG - Intergenic
1177910678 21:27027258-27027280 AAAGTCTGTTTCAGAAAGACTGG - Intergenic
1179089790 21:38254187-38254209 AAAGCATGCTTAACAAAGCCTGG + Intronic
1179188098 21:39100355-39100377 AAACCCTGCTTCACAAAGATAGG - Intergenic
1180244565 21:46538437-46538459 CATCCCTGCGTCACAAGGACTGG - Intronic
1182046162 22:27275780-27275802 TAACCCTCCTGCACAAAGCCTGG - Intergenic
1184513906 22:44948720-44948742 AAACCCGGCTTCACAAAGACAGG + Intronic
949460472 3:4287572-4287594 AAACACAGCTTCACAAAGATAGG + Intronic
950758430 3:15197996-15198018 AAACCCTGCTTCATAAAGATAGG + Intergenic
952860571 3:37808994-37809016 AGACCCTGCTTCTCAATGAGAGG + Intronic
954470074 3:50686266-50686288 AAACTCTGCTGCACAAAAATAGG + Intronic
956089506 3:65650761-65650783 AAATTCTGATTCACAAAGTCTGG - Intronic
961435599 3:126914389-126914411 AAACCCTTATTCACAAAAACAGG + Intronic
961580837 3:127880760-127880782 AAACCCTGCTTCACAAACAGAGG + Intergenic
961667886 3:128504877-128504899 AAACCCGGCTTCAGATTGACCGG - Intergenic
962240297 3:133746300-133746322 CAACCCGGCTGCACAAACACGGG + Exonic
962586051 3:136843634-136843656 AGACCCTGTTTCAAAAAGGCTGG + Intronic
963356308 3:144212581-144212603 AAACCCTGCTTCACAAAGATAGG + Intergenic
963842019 3:150117401-150117423 AAACTCTGCTGCTCTAAGACAGG + Intergenic
964139832 3:153385092-153385114 GAGCCCTGCTACACAAATACTGG - Intergenic
964495479 3:157285285-157285307 AATCTGTGCTTCACAAAGGCTGG + Intronic
964583402 3:158266754-158266776 AAACCCTGTATCAAAAAGAGGGG - Intronic
964612923 3:158632946-158632968 AAATGCTACTTCACAAAGATAGG + Intergenic
965488013 3:169302390-169302412 AAACCCTGAGGCACACAGACTGG - Intronic
967294799 3:187954537-187954559 ACACCCTACTTCCCAAAGCCTGG + Intergenic
967658976 3:192082062-192082084 AATCCCTGATTCACAAAGAAAGG + Intergenic
969077574 4:4592449-4592471 AAACCAGGCTTCAGAAGGACAGG + Intergenic
971619574 4:28838606-28838628 AAACCCAACTTCACACAGATAGG - Intergenic
972533729 4:39982345-39982367 AACCCCTGCTTCCCAGAGTCAGG - Intergenic
975417449 4:74121401-74121423 AAACCCTACTTCACAAAGATAGG - Intronic
975625355 4:76340567-76340589 AAACACTGCTTCACAAAGATAGG - Intronic
976122718 4:81800583-81800605 AAACCCTGCTTCACAAAGATAGG + Intronic
976180400 4:82393539-82393561 AAACCCTGCTTCACAAAGATAGG - Intergenic
976208145 4:82641305-82641327 TACCCCTGCTCCACAAAGCCAGG - Intronic
978222463 4:106293262-106293284 AAACCCTGCTTCACAAAGATAGG - Intronic
978315962 4:107437526-107437548 AAACACTGTTTCACAACGATAGG + Intergenic
979525175 4:121708671-121708693 AAACCCTGATTTACAGAGGCAGG - Intergenic
979829230 4:125280146-125280168 AAACCCTTCTTCACAAAGATAGG - Intergenic
980991343 4:139741006-139741028 AAACCCAGCTTCCCACAGACAGG - Intronic
981295682 4:143128043-143128065 AAACCCTGCTCTAGAAATACTGG + Intergenic
981297387 4:143147419-143147441 ATATCCTGCTTCACAAATACAGG + Intergenic
982039799 4:151385513-151385535 AAACCCTGCTTCACAAAGATAGG + Intergenic
983677640 4:170314707-170314729 AAACTCAGCTTCACAAAGATAGG - Intergenic
984247841 4:177296665-177296687 AGACCCTGCTTCAAAAAAAAAGG + Intergenic
985753417 5:1697339-1697361 AAACTCTGCTTCACAAAGACAGG + Intergenic
986267320 5:6201792-6201814 AAACCCTGCAGCTCAAAGAGAGG + Intergenic
986305769 5:6514894-6514916 AAACCCTGCTCCAAACATACAGG + Intergenic
986350178 5:6870326-6870348 CAACCCTGCTTCACAAAGATAGG + Intergenic
987423019 5:17743227-17743249 AAAAGCTGCTTTACAAAGTCTGG - Intergenic
987993180 5:25241930-25241952 AAACCCTGCTTCACAAAGATAGG + Intergenic
988136110 5:27173872-27173894 AAACCCTGCTTCACAAAGATTGG - Intergenic
988272124 5:29031096-29031118 AAACCCTGGTCCCCAAAGAAGGG + Intergenic
990501857 5:56404370-56404392 AAAGCCATCTTCACAAGGACTGG - Intergenic
992950657 5:81853989-81854011 AAAGCCTGATTTACAAAGACTGG + Intergenic
993034079 5:82737709-82737731 CAACCATGCTTCACACAGAAAGG + Intergenic
993411923 5:87584716-87584738 AAACCCCACTTAACAAAGAATGG + Intergenic
995212848 5:109560316-109560338 ATACCCTGCTTCCCAAGAACAGG - Intergenic
995461876 5:112411853-112411875 CAAGCCTGCTTCTCAAACACAGG + Intronic
995463903 5:112431097-112431119 AAACCCTGCTTCACAAAGATAGG + Intergenic
995861355 5:116644222-116644244 AAACCCTGCTTCACAAAGATAGG + Intergenic
996085670 5:119302481-119302503 AAAACATCCTTCCCAAAGACAGG - Intronic
997065382 5:130553630-130553652 TAGCCCTGCTTCAGAAAGAGCGG + Intergenic
997719101 5:136063979-136064001 AAAACCTGTTTGGCAAAGACAGG - Intergenic
997900374 5:137758015-137758037 AAACCCTGCTTCACAAATATAGG + Intergenic
998523779 5:142824369-142824391 ACACCCTGGTTCTCTAAGACAGG + Intronic
998757886 5:145400674-145400696 ACACCCTCCTTCCCACAGACTGG - Intergenic
999130926 5:149282569-149282591 AAAACTTTCTTTACAAAGACAGG - Intronic
999193773 5:149768103-149768125 AAACCCTGCTTCACAGGGATAGG + Intronic
1000664654 5:163980077-163980099 AAACCCTGCATTAAAAAGTCAGG - Intergenic
1000916242 5:167085672-167085694 AAACACAACTTCATAAAGACAGG - Intergenic
1001894462 5:175366505-175366527 AAACCCTGCTTCGCAAAGATAGG - Intergenic
1004181393 6:13383461-13383483 AAACTCAGCTTCACAGAGATAGG - Intronic
1004599281 6:17132154-17132176 AAACCCTGCTGCACAAAGATGGG - Intergenic
1004770081 6:18771507-18771529 ATACCCTGCTTCACAAAGTTAGG - Intergenic
1005591861 6:27337064-27337086 AAACCCTGCTTGAGAAGAACCGG + Intergenic
1006969667 6:38028852-38028874 ATGCCTTGCTTCACAAAGAAAGG - Intronic
1007339525 6:41181730-41181752 ACACCCTGCCTGGCAAAGACAGG + Intergenic
1007499697 6:42287506-42287528 GACCCCTGCTTCACAGAGAATGG + Intronic
1011513021 6:88122369-88122391 AGACCTTGCTCCACAAAGTCAGG - Intergenic
1013036079 6:106384590-106384612 AAACCCTGCTTCACAAAGATAGG + Intergenic
1013654219 6:112228629-112228651 AAAGCCTGTTACACAAAGCCAGG + Intronic
1013785233 6:113772153-113772175 AAACTCTGCTTTACAGAGTCAGG + Intergenic
1015828990 6:137347009-137347031 CAACCCTGCCTCAAAAAGAAAGG + Intergenic
1016442483 6:144098021-144098043 AAACCCTCATTCACATAGATAGG + Intergenic
1016983168 6:149871876-149871898 AAAACCTGCTTTTCAAAAACTGG - Intergenic
1017097329 6:150816199-150816221 AAACCCTGCTTCACAAAGATAGG + Intronic
1018596551 6:165487254-165487276 AAACCCTGCTTCACAAAGACAGG - Intronic
1018664527 6:166122927-166122949 AAACCCTGCTTCACAAAGACAGG + Intergenic
1019906699 7:4070345-4070367 AAACTCTGCTTTGCAAAGACAGG + Intronic
1020561768 7:9737060-9737082 TGACCTTGCTTCAAAAAGACTGG - Intergenic
1020946382 7:14613608-14613630 AAAACCTCCTCCACAAAGAAAGG + Intronic
1020982633 7:15090454-15090476 AAAACATGCTTTACAAAGAATGG + Intergenic
1022122410 7:27322067-27322089 AAACCCTCCTTCAGAAGGAAAGG + Intergenic
1022257330 7:28672535-28672557 AAACTCTGATTGACAGAGACTGG + Intronic
1024747724 7:52427547-52427569 CAGCCCTGCTTCACAAGGAGTGG + Intergenic
1026649941 7:72208181-72208203 AAATCCTGATTCACATAGATGGG + Intronic
1027795691 7:82691048-82691070 AAATCCTGCATCAAAAAGACAGG - Intergenic
1029101260 7:98132094-98132116 AGGCCCTGCTTGCCAAAGACAGG + Intronic
1030064525 7:105649147-105649169 AAACACTGCTCCACAAAGAAAGG - Intronic
1031514550 7:122685986-122686008 AAAACCAGCTTCACAAATACTGG - Intronic
1034047645 7:147946957-147946979 ATACCCTTCTTCACAGGGACAGG + Intronic
1034822321 7:154227701-154227723 TCAGCCTGCTTCACAAGGACAGG + Intronic
1036382638 8:8247412-8247434 AAATCCTGCTTCACAAAGACAGG - Intergenic
1036669010 8:10767691-10767713 AGATCCTGCCTCCCAAAGACGGG + Intronic
1039716899 8:40119448-40119470 TTACCCAGCTTCAGAAAGACTGG - Intergenic
1042172330 8:66004260-66004282 AAGCCCTGCTTCACAAAGACAGG - Intergenic
1043050992 8:75385339-75385361 AAACCCTGCTTCACAAGGATAGG - Intergenic
1043231160 8:77803115-77803137 AAACCCTGCTTTGGAAAGATAGG + Intergenic
1043306249 8:78800305-78800327 AAACCCTGTCTCAAAAAGAGAGG - Intronic
1044031757 8:87247045-87247067 AAACTCTGCTTCACAAAGGTAGG + Intronic
1046238127 8:111454068-111454090 GAAGCCTGCTTCACAAAGATAGG - Intergenic
1046438816 8:114231259-114231281 ATATCCTGCTTCACAAGGACTGG + Intergenic
1050057080 9:1667005-1667027 AAACCCTGCTTCACAAAGATAGG - Intergenic
1051034622 9:12728671-12728693 AAGACCTGCTTAAGAAAGACGGG + Intergenic
1052125753 9:24772748-24772770 ACACCCTGCTTCATAAAGGTTGG - Intergenic
1052838058 9:33265871-33265893 AAACAGTGGTTCACAAAGAAGGG - Intronic
1057775835 9:98008617-98008639 AAACTTTGCTTCACAAAGATAGG - Intronic
1058155379 9:101508913-101508935 AAACCCTGTTTCACAAAGGTAGG + Intronic
1058229481 9:102408214-102408236 AAACTCTGCTTCACAAAGATCGG - Intergenic
1060940514 9:127540680-127540702 AAACCCTGTTCCACACGGACGGG + Intronic
1061932451 9:133840232-133840254 AAACTCTGCTTCCCGAAGCCGGG - Intronic
1188065688 X:25656668-25656690 AAACCCTGCTTCACAATGATAGG + Intergenic
1188246239 X:27839369-27839391 AAACCCTGCTTTGTAAAGATAGG - Intergenic
1188970374 X:36607760-36607782 ATACCTTTCTTCACAAAGTCTGG - Intergenic
1191719719 X:64219373-64219395 AGACCCTGCCTCACACAGTCTGG - Intergenic
1192778973 X:74274929-74274951 AAAACCTGATTTACAAAAACAGG - Intergenic
1198340311 X:135707736-135707758 AAACCCTGTCTCAAAAAGAATGG - Intergenic
1198343792 X:135740453-135740475 AAACCCTGTCTCAAAAAGAATGG - Intergenic
1201757877 Y:17507215-17507237 AAACTCTGCTTCAGAAAGACAGG - Intergenic
1201843677 Y:18398767-18398789 AAACTCTGCTTCAGAAAGACAGG + Intergenic