ID: 933483148

View in Genome Browser
Species Human (GRCh38)
Location 2:82882558-82882580
Sequence TATTTCTCACACACACAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933483148_933483151 23 Left 933483148 2:82882558-82882580 CCAGGCTGTGTGTGTGAGAAATA No data
Right 933483151 2:82882604-82882626 CAGCATCAGGTGCAATGTGTTGG No data
933483148_933483152 24 Left 933483148 2:82882558-82882580 CCAGGCTGTGTGTGTGAGAAATA No data
Right 933483152 2:82882605-82882627 AGCATCAGGTGCAATGTGTTGGG No data
933483148_933483149 10 Left 933483148 2:82882558-82882580 CCAGGCTGTGTGTGTGAGAAATA No data
Right 933483149 2:82882591-82882613 ATTCTCATTTGTCCAGCATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933483148 Original CRISPR TATTTCTCACACACACAGCC TGG (reversed) Intergenic
No off target data available for this crispr