ID: 933484274

View in Genome Browser
Species Human (GRCh38)
Location 2:82897590-82897612
Sequence CAGAGCGCTAAGGGGTAGCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933484269_933484274 10 Left 933484269 2:82897557-82897579 CCAGCACTCAAGGGGGAGAGGAG No data
Right 933484274 2:82897590-82897612 CAGAGCGCTAAGGGGTAGCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933484274 Original CRISPR CAGAGCGCTAAGGGGTAGCA TGG Intergenic
No off target data available for this crispr