ID: 933485316

View in Genome Browser
Species Human (GRCh38)
Location 2:82914441-82914463
Sequence ACTCATAACCTGCTGTTGAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933485314_933485316 -7 Left 933485314 2:82914425-82914447 CCTCCAAAACTTAACTACTCATA No data
Right 933485316 2:82914441-82914463 ACTCATAACCTGCTGTTGACTGG No data
933485315_933485316 -10 Left 933485315 2:82914428-82914450 CCAAAACTTAACTACTCATAACC No data
Right 933485316 2:82914441-82914463 ACTCATAACCTGCTGTTGACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933485316 Original CRISPR ACTCATAACCTGCTGTTGAC TGG Intergenic
No off target data available for this crispr