ID: 933486521

View in Genome Browser
Species Human (GRCh38)
Location 2:82931644-82931666
Sequence ATGCATACACAGATGAAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933486521_933486522 24 Left 933486521 2:82931644-82931666 CCTCTTTTCATCTGTGTATGCAT No data
Right 933486522 2:82931691-82931713 ATGTATGTATAAATGCAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933486521 Original CRISPR ATGCATACACAGATGAAAAG AGG (reversed) Intergenic
No off target data available for this crispr