ID: 933486871

View in Genome Browser
Species Human (GRCh38)
Location 2:82935325-82935347
Sequence TAATGAGTAAGGAGGGCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933486871_933486875 -5 Left 933486871 2:82935325-82935347 CCAGCTGCCCTCCTTACTCATTA No data
Right 933486875 2:82935343-82935365 CATTAGCATGACACTCCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933486871 Original CRISPR TAATGAGTAAGGAGGGCAGC TGG (reversed) Intergenic
No off target data available for this crispr