ID: 933486883

View in Genome Browser
Species Human (GRCh38)
Location 2:82935420-82935442
Sequence CAGGTTATTTGGATCTTTCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933486883_933486894 29 Left 933486883 2:82935420-82935442 CCTAGAAAGATCCAAATAACCTG No data
Right 933486894 2:82935472-82935494 ATTTACTTGCAATTGAAAGTGGG No data
933486883_933486893 28 Left 933486883 2:82935420-82935442 CCTAGAAAGATCCAAATAACCTG No data
Right 933486893 2:82935471-82935493 AATTTACTTGCAATTGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933486883 Original CRISPR CAGGTTATTTGGATCTTTCT AGG (reversed) Intergenic
No off target data available for this crispr