ID: 933486886

View in Genome Browser
Species Human (GRCh38)
Location 2:82935443-82935465
Sequence GTGGGTCAATGCAAATTGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933486886_933486894 6 Left 933486886 2:82935443-82935465 CCCCTCAATTTGCATTGACCCAC No data
Right 933486894 2:82935472-82935494 ATTTACTTGCAATTGAAAGTGGG No data
933486886_933486893 5 Left 933486886 2:82935443-82935465 CCCCTCAATTTGCATTGACCCAC No data
Right 933486893 2:82935471-82935493 AATTTACTTGCAATTGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933486886 Original CRISPR GTGGGTCAATGCAAATTGAG GGG (reversed) Intergenic