ID: 933486887 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:82935444-82935466 |
| Sequence | GGTGGGTCAATGCAAATTGA GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 933486887_933486893 | 4 | Left | 933486887 | 2:82935444-82935466 | CCCTCAATTTGCATTGACCCACC | No data | ||
| Right | 933486893 | 2:82935471-82935493 | AATTTACTTGCAATTGAAAGTGG | No data | ||||
| 933486887_933486894 | 5 | Left | 933486887 | 2:82935444-82935466 | CCCTCAATTTGCATTGACCCACC | No data | ||
| Right | 933486894 | 2:82935472-82935494 | ATTTACTTGCAATTGAAAGTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 933486887 | Original CRISPR | GGTGGGTCAATGCAAATTGA GGG (reversed) | Intergenic | ||