ID: 933486888 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 2:82935445-82935467 |
Sequence | GGGTGGGTCAATGCAAATTG AGG (reversed) |
Strand | - |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | ||||
Summary |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
933486888_933486894 | 4 | Left | 933486888 | 2:82935445-82935467 | CCTCAATTTGCATTGACCCACCC | No data | ||
Right | 933486894 | 2:82935472-82935494 | ATTTACTTGCAATTGAAAGTGGG | No data | ||||
933486888_933486893 | 3 | Left | 933486888 | 2:82935445-82935467 | CCTCAATTTGCATTGACCCACCC | No data | ||
Right | 933486893 | 2:82935471-82935493 | AATTTACTTGCAATTGAAAGTGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
933486888 | Original CRISPR | GGGTGGGTCAATGCAAATTG AGG (reversed) | Intergenic | ||