ID: 933486888

View in Genome Browser
Species Human (GRCh38)
Location 2:82935445-82935467
Sequence GGGTGGGTCAATGCAAATTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933486888_933486894 4 Left 933486888 2:82935445-82935467 CCTCAATTTGCATTGACCCACCC No data
Right 933486894 2:82935472-82935494 ATTTACTTGCAATTGAAAGTGGG No data
933486888_933486893 3 Left 933486888 2:82935445-82935467 CCTCAATTTGCATTGACCCACCC No data
Right 933486893 2:82935471-82935493 AATTTACTTGCAATTGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933486888 Original CRISPR GGGTGGGTCAATGCAAATTG AGG (reversed) Intergenic
No off target data available for this crispr