ID: 933486894

View in Genome Browser
Species Human (GRCh38)
Location 2:82935472-82935494
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933486887_933486894 5 Left 933486887 2:82935444-82935466 CCCTCAATTTGCATTGACCCACC No data
Right 933486894 2:82935472-82935494 ATTTACTTGCAATTGAAAGTGGG No data
933486888_933486894 4 Left 933486888 2:82935445-82935467 CCTCAATTTGCATTGACCCACCC No data
Right 933486894 2:82935472-82935494 ATTTACTTGCAATTGAAAGTGGG No data
933486885_933486894 10 Left 933486885 2:82935439-82935461 CCTGCCCCTCAATTTGCATTGAC No data
Right 933486894 2:82935472-82935494 ATTTACTTGCAATTGAAAGTGGG No data
933486883_933486894 29 Left 933486883 2:82935420-82935442 CCTAGAAAGATCCAAATAACCTG No data
Right 933486894 2:82935472-82935494 ATTTACTTGCAATTGAAAGTGGG No data
933486886_933486894 6 Left 933486886 2:82935443-82935465 CCCCTCAATTTGCATTGACCCAC No data
Right 933486894 2:82935472-82935494 ATTTACTTGCAATTGAAAGTGGG No data
933486884_933486894 18 Left 933486884 2:82935431-82935453 CCAAATAACCTGCCCCTCAATTT No data
Right 933486894 2:82935472-82935494 ATTTACTTGCAATTGAAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type