ID: 933488368

View in Genome Browser
Species Human (GRCh38)
Location 2:82950819-82950841
Sequence GAGGGTGAGCAGAAGGAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933488368_933488380 23 Left 933488368 2:82950819-82950841 CCACCCTCCTTCTGCTCACCCTC No data
Right 933488380 2:82950865-82950887 CCAGTCCCAATGAGATGAGCCGG 0: 109
1: 348
2: 415
3: 240
4: 289

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933488368 Original CRISPR GAGGGTGAGCAGAAGGAGGG TGG (reversed) Intergenic
No off target data available for this crispr