ID: 933488658

View in Genome Browser
Species Human (GRCh38)
Location 2:82955951-82955973
Sequence AGAGAGAAGAAGAAAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933488655_933488658 18 Left 933488655 2:82955910-82955932 CCAATCATTAAAAGAAAGAGGAG No data
Right 933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933488658 Original CRISPR AGAGAGAAGAAGAAAGAGGA AGG Intergenic
No off target data available for this crispr