ID: 933492435

View in Genome Browser
Species Human (GRCh38)
Location 2:83003860-83003882
Sequence ATTTGGTGCTGGGGGATCCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933492435_933492442 4 Left 933492435 2:83003860-83003882 CCTGGGATCCCCCAGCACCAAAT No data
Right 933492442 2:83003887-83003909 TTTAAAATTTGCATACATTAGGG 0: 5
1: 20
2: 61
3: 233
4: 1086
933492435_933492441 3 Left 933492435 2:83003860-83003882 CCTGGGATCCCCCAGCACCAAAT No data
Right 933492441 2:83003886-83003908 TTTTAAAATTTGCATACATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933492435 Original CRISPR ATTTGGTGCTGGGGGATCCC AGG (reversed) Intergenic
No off target data available for this crispr