ID: 933498002

View in Genome Browser
Species Human (GRCh38)
Location 2:83075735-83075757
Sequence AGATGGACACAAATGCAGAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933498002_933498003 -9 Left 933498002 2:83075735-83075757 CCTATCTGCATTTGTGTCCATCT No data
Right 933498003 2:83075749-83075771 TGTCCATCTTGTATTATCTCAGG No data
933498002_933498005 0 Left 933498002 2:83075735-83075757 CCTATCTGCATTTGTGTCCATCT No data
Right 933498005 2:83075758-83075780 TGTATTATCTCAGGATACTAAGG No data
933498002_933498006 3 Left 933498002 2:83075735-83075757 CCTATCTGCATTTGTGTCCATCT No data
Right 933498006 2:83075761-83075783 ATTATCTCAGGATACTAAGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933498002 Original CRISPR AGATGGACACAAATGCAGAT AGG (reversed) Intergenic
No off target data available for this crispr