ID: 933502572

View in Genome Browser
Species Human (GRCh38)
Location 2:83133776-83133798
Sequence CAGAGTGACCATGGTGATGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933502570_933502572 12 Left 933502570 2:83133741-83133763 CCGTCTCTGGCAAATACATGCTC No data
Right 933502572 2:83133776-83133798 CAGAGTGACCATGGTGATGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933502572 Original CRISPR CAGAGTGACCATGGTGATGA TGG Intergenic
No off target data available for this crispr