ID: 933502874

View in Genome Browser
Species Human (GRCh38)
Location 2:83138874-83138896
Sequence AAGGAGCAGGAGAAGGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933502867_933502874 17 Left 933502867 2:83138834-83138856 CCATGCCTAACGTCATCATACTT No data
Right 933502874 2:83138874-83138896 AAGGAGCAGGAGAAGGAGAAGGG No data
933502868_933502874 12 Left 933502868 2:83138839-83138861 CCTAACGTCATCATACTTAAATT No data
Right 933502874 2:83138874-83138896 AAGGAGCAGGAGAAGGAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933502874 Original CRISPR AAGGAGCAGGAGAAGGAGAA GGG Intergenic
No off target data available for this crispr