ID: 933503938

View in Genome Browser
Species Human (GRCh38)
Location 2:83153806-83153828
Sequence TGTGCATTAGAATCAACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933503937_933503938 9 Left 933503937 2:83153774-83153796 CCAAGTCTAGATCAATGGTTTTC No data
Right 933503938 2:83153806-83153828 TGTGCATTAGAATCAACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933503938 Original CRISPR TGTGCATTAGAATCAACTGT AGG Intergenic