ID: 933506315

View in Genome Browser
Species Human (GRCh38)
Location 2:83181140-83181162
Sequence GCCAGCCGGCCTGCAAGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933506312_933506315 -8 Left 933506312 2:83181125-83181147 CCCACACTTGGAGCAGCCAGCCG 0: 3
1: 18
2: 127
3: 479
4: 657
Right 933506315 2:83181140-83181162 GCCAGCCGGCCTGCAAGCCCCGG No data
933506313_933506315 -9 Left 933506313 2:83181126-83181148 CCACACTTGGAGCAGCCAGCCGG 0: 5
1: 57
2: 350
3: 431
4: 547
Right 933506315 2:83181140-83181162 GCCAGCCGGCCTGCAAGCCCCGG No data
933506311_933506315 -7 Left 933506311 2:83181124-83181146 CCCCACACTTGGAGCAGCCAGCC No data
Right 933506315 2:83181140-83181162 GCCAGCCGGCCTGCAAGCCCCGG No data
933506304_933506315 29 Left 933506304 2:83181088-83181110 CCAGCGCGAGTTCTGGGAGGGGG No data
Right 933506315 2:83181140-83181162 GCCAGCCGGCCTGCAAGCCCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933506315 Original CRISPR GCCAGCCGGCCTGCAAGCCC CGG Intergenic
No off target data available for this crispr