ID: 933506846

View in Genome Browser
Species Human (GRCh38)
Location 2:83187482-83187504
Sequence GTTTCAAAGGGCAAAACTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933506846_933506856 20 Left 933506846 2:83187482-83187504 CCCCCAGTTTTGCCCTTTGAAAC No data
Right 933506856 2:83187525-83187547 GGCGTTTCACTTTATATGCAAGG No data
933506846_933506852 -1 Left 933506846 2:83187482-83187504 CCCCCAGTTTTGCCCTTTGAAAC No data
Right 933506852 2:83187504-83187526 CTCCCAGTAACACCTTCGTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933506846 Original CRISPR GTTTCAAAGGGCAAAACTGG GGG (reversed) Intergenic
No off target data available for this crispr