ID: 933514486

View in Genome Browser
Species Human (GRCh38)
Location 2:83283516-83283538
Sequence AGCCCGGAAGCCCCTGCTTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933514481_933514486 13 Left 933514481 2:83283480-83283502 CCAATTGTCAACCAGAAAATGTT 0: 212
1: 239
2: 223
3: 458
4: 868
Right 933514486 2:83283516-83283538 AGCCCGGAAGCCCCTGCTTTGGG No data
933514480_933514486 19 Left 933514480 2:83283474-83283496 CCTCAACCAATTGTCAACCAGAA 0: 8
1: 7
2: 4
3: 26
4: 262
Right 933514486 2:83283516-83283538 AGCCCGGAAGCCCCTGCTTTGGG No data
933514482_933514486 2 Left 933514482 2:83283491-83283513 CCAGAAAATGTTTAAATTTACCT 0: 194
1: 216
2: 152
3: 115
4: 621
Right 933514486 2:83283516-83283538 AGCCCGGAAGCCCCTGCTTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933514486 Original CRISPR AGCCCGGAAGCCCCTGCTTT GGG Intergenic
No off target data available for this crispr