ID: 933518083

View in Genome Browser
Species Human (GRCh38)
Location 2:83331481-83331503
Sequence GGACAGAGCAGAACAAAAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933518083_933518088 2 Left 933518083 2:83331481-83331503 CCAGCTTTTGTTCTGCTCTGTCC No data
Right 933518088 2:83331506-83331528 AGGGATCAAAACTATTGTTCAGG No data
933518083_933518090 8 Left 933518083 2:83331481-83331503 CCAGCTTTTGTTCTGCTCTGTCC No data
Right 933518090 2:83331512-83331534 CAAAACTATTGTTCAGGGCTAGG No data
933518083_933518089 3 Left 933518083 2:83331481-83331503 CCAGCTTTTGTTCTGCTCTGTCC No data
Right 933518089 2:83331507-83331529 GGGATCAAAACTATTGTTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933518083 Original CRISPR GGACAGAGCAGAACAAAAGC TGG (reversed) Intergenic
No off target data available for this crispr