ID: 933518109

View in Genome Browser
Species Human (GRCh38)
Location 2:83331713-83331735
Sequence CCTTCTTGTCAAAATATTAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933518109_933518111 -7 Left 933518109 2:83331713-83331735 CCATTAATATTTTGACAAGAAGG No data
Right 933518111 2:83331729-83331751 AAGAAGGCAAGACAATTGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933518109 Original CRISPR CCTTCTTGTCAAAATATTAA TGG (reversed) Intergenic
No off target data available for this crispr