ID: 933525039

View in Genome Browser
Species Human (GRCh38)
Location 2:83426566-83426588
Sequence GGCTTGGGTAAAGTTTCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933525039_933525049 21 Left 933525039 2:83426566-83426588 CCATGTGAAACTTTACCCAAGCC No data
Right 933525049 2:83426610-83426632 CAAGGTTCTGAAAGAGTCAAGGG No data
933525039_933525048 20 Left 933525039 2:83426566-83426588 CCATGTGAAACTTTACCCAAGCC No data
Right 933525048 2:83426609-83426631 CCAAGGTTCTGAAAGAGTCAAGG No data
933525039_933525044 3 Left 933525039 2:83426566-83426588 CCATGTGAAACTTTACCCAAGCC No data
Right 933525044 2:83426592-83426614 CCTTTACAAGAAGTACCCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933525039 Original CRISPR GGCTTGGGTAAAGTTTCACA TGG (reversed) Intergenic
No off target data available for this crispr