ID: 933525040

View in Genome Browser
Species Human (GRCh38)
Location 2:83426581-83426603
Sequence TTCTTGTAAAGGATAGGCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
933525040_933525048 5 Left 933525040 2:83426581-83426603 CCCAAGCCTATCCTTTACAAGAA No data
Right 933525048 2:83426609-83426631 CCAAGGTTCTGAAAGAGTCAAGG No data
933525040_933525049 6 Left 933525040 2:83426581-83426603 CCCAAGCCTATCCTTTACAAGAA No data
Right 933525049 2:83426610-83426632 CAAGGTTCTGAAAGAGTCAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
933525040 Original CRISPR TTCTTGTAAAGGATAGGCTT GGG (reversed) Intergenic
No off target data available for this crispr